PCR Reagent & Kits
- Сортировать:
- Вид таблицей
-
LuminoCt® SYBR® Green qPCR ReadyMix™
NACRES: NA.55
Кат. номер L6544-100RXN L6544-500RXN L6544-2000RXN General descriptionLuminoCt SYBR Green qPCR ReadyMix is designed to deliver unsurpassed assay speeds without sacrificing accuracy, precision, or sensitivity. Extensive design and validation of the ReadyMix chemistry has virtually eliminated the need for optimization when LuminoCt is used in conjunction with properly designed primers. Inclusion of JumpStart™ Taq antibody in the ReadyMix eliminates polymerase activity at ambient temperatures without causing the performance issues associated with chemically modified hot-start Taq. This allows for very rapid activation of the Taq and delivers unparalleled assay sensitivity, while allowing for benchtop reaction setup.- Kit is designed to perform SYBR Green-based qPCR assays on commonly available real-time instrument platforms
- ReadyMix requires the addition of reference dye (provided in kit) when being used on real-time instruments that require ROX passive reference dye for normalization of qPCR assays
- Kit is not compatible with qPCR instruments that utilize glass capillary tubes
ApplicationLuminoCt® SYBR® Green qPCR ReadyMix™ has been used for fast qPCR and quantitative RT-PCR amplifications.
Features and Benefits- Assay results in as little as 25 minutes
- Unsurpassed accuracy, precision, and sensitivity
- Virtually eliminates the need to optimize assay parameters
Packaging
Default reaction volume is 50 µL
100RXN is packaged as 1 X 2.5 mL
500RXN is packaged as 1 X 12.5 mL
2000RXN is packaged as 1 X 50 mLOther Notes- At a minimum, use software to design primers for assays and ensure that qPCR amplicons are <200 bp
- Sigma recommends designing primers and probes with Beacon Designer software,
- To order primers and probes from Sigma, visit: www.sigma.com/oligos,
Legal InformationEppendorf is a registered trademark of Eppendorf AG
JumpStart is a trademark of Sigma-Aldrich Co. LLC
LuminoCt is a registered trademark of Sigma-Aldrich Co. LLC
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies
SabreLite is a registered trademark of Pelican Products, Inc.ПараметрыQuality Level 200, form liquid feature hotstart application(s) qPCR: suitable color colorless Featured Industry Agriculture compatibility for use with ABI 5700, for use with ABI 7000, for use with ABI 7300, for use with ABI 7500 Fast, for use with ABI 7500, for use with ABI 7700, for use with ABI 7900 Fast, for use with ABI 7900 HT, for use with ABI 7900, for use with ABI StepOne, for use with ABI StepOnePlus, for use with ABI ViiA 7, for use with Bio-Rad CFX384, for use with Bio-Rad CFX96, for use with Bio-Rad MJ Chromo4, for use with Bio-Rad MJ Opticon 2, for use with Bio-Rad MJ Opticon Cepheid SmartCycler, for use with Bio-Rad MJ Opticon, for use with Bio-Rad MiniOpticon, for use with Eppendorf® Mastercycler ep realplex2 s, for use with Eppendorf® Mastercycler ep realplex, for use with Illumina Eco qPCR, for use with Qiagen Corbett Rotor-Gene 3000, for use with Qiagen Corbett Rotor-Gene 6000, for use with Qiagen Corbett Rotor-Gene Q, for use with Roche LightCycler 480, for use with Strategene Mx3000P, for use with Strategene Mx3005P, for use with Strategene Mx4000 detection method SYBR® Green shipped in wet ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Узнать цену -
Lysis solution for blood
NACRES: NA.25
Кат. номер L3289-.3ML L3289-.3ML-KC L3289-2.5ML-KC L3289-25ML-KC L3289-2.5ML L3289-25ML General descriptionThis lysis solution is a component of the REDExtract-N-Amp™ Blood PCR Kits for the rapid extraction and amplification of human genomic DNA from whole blood, whole blood dried on a blood card, and cultured mammalian cells.ApplicationLysis solution for blood has been used for lysis of approximately 2X104 cells in 10 µl of blood for polymerase chain reaction (PCR) amplification and sequencing of library alleles from screened cell lines.Legal InformationREDExtract-N-Amp is a trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, grade for molecular biology form liquid storage temp. 20°C
Safety Informationpictograms GHS05 signalword Danger hcodes H290 - H314 pcodes P234 - P280 - P303 + P361 + P353 - P304 + P340 + P310 - P305 + P351 + P338 - P363 RIDADR UN 3266 8 / PGIII WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
M-MLV Reverse Transcriptase
CAS Number: 9068-38-6 MDL number: MFCD00283754 NACRES: NA.55
Кат. номер M1302-40KU M1302-200KU M1302-1KU General descriptionM-MLV (Moloney murine leukemia virus) reverse transcriptase enzyme is isolated from E. coli expressing a portion of the pol gene of M-MLV on a plasmid. MoMLV RT is made up of 671 amino acid residues. It is a DNA polymerase that uses single-stranded RNA, DNA, or an RNA-DNA hybrid (using a primer) to synthesize a complementary DNA strand.ApplicationM-MLV Reverse Transcriptase has been used:- for the preparation of cDNA libraries or for first strand cDNA synthesis
- for use in a 2-step RT-PCR assay
- for the synthesis of cDNA that is further used in cloning
M-MLV Reverse Transcriptase has been used:- to synthesize cDNA
- in quantitative realtime-polymerase chain reaction (RT-qPCR)
- in reverse transcription
M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase is a DNA polymerase that uses single-stranded RNA, DNA, or an RNA-DNA hybrid (using a primer) to synthesize a complementary DNA strand. M-MLV is used for the preparation of cDNA libraries or for first strand cDNA synthesis for use in RT-PCR reactions.
Features and Benefits- Thermostable reverse transcriptase active at 37 °C.
- Can be used to generate first strand cDNA of up to 7 kb.
Packaging
Supplied with 10x M-MLV reverse transcriptase buffer containing DTT.
Unit Definition
One unit incorporates 1 nmol of TTP into acid precipitable material in 10 min. at 37 °C using poly(A):oligo dT as a template:primer.
Preparation Note
The enzyme is purified from Escherichia coli expressing the pol gene of M-MLV on a plasmid.Legal InformationPurchase of this product is accompanied by a limited license for use in the Polymerase Chain Reaction (PCR) process for research purposes only and in conjunction with a thermal cycler whose use in the automated performance of the PCR process is covered by an up-front license fee, either by payment to Applied Biosystems or as purchased, i.e., and authorized thermal cycler.ПараметрыQuality Level 200, recombinant expressed in E. coli feature hotstart: no concentration 200 units/µL application(s) RT-PCR: suitable color colorless shipped in wet ice storage temp. 20°C
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
Magnesium chloride solution
Empirical Formula (Hill Notation): Cl2Mg Linear Formula: MgCl2 CAS Number: 7786-30-3 Molecular Weight: 95.21 MDL number: MFCD00011106 PubChem Substance ID: 57654422 NACRES: NA.52
Кат. номер M8787-25ML-KC M8787-25ML M8787-20RXN M8787-1.5ML-KC M8787-5ML-KC M8787-PH M8787-1VL M8787-1.5ML M8787-5ML M8787-10ML M8787-10ML-KC M8787-1VL-PW M8787-5VL M8770-1MG-PW M8787-5ML-PW M8787-EW Application- For routine PCR amplifications.
- Optimization of MgCl2 concentration in PCR reactions for improved yield.
Suitability
Suitable for optimization of polymerase chain reactions.Параметрыgrade PCR Reagent Quality Level 300, form liquid packaging vial of 1.5 mL concentration 25 mM±1 mM application(s) PCR: suitable color colorless Featured Industry Agriculture
Diagnostic Assay Manufacturingforeign activity DNase, RNase, none detected storage temp. 2-8°C SMILES string Cl[Mg]Cl InChI 1S/2ClH.Mg/h2*1H;/q;;+2/p-2 InChI key TWRXJAOTZQYOKJ-UHFFFAOYSA-L
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport WGK Germany nwg Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
Methylated Control DNA
NACRES: NA.55
Кат. номер M8570-1VL M8570-1VL-PW M8570-1VL-KC General descriptionFully methylated Jurkat DNA. 5-methyl-cytidine (5mC) content determined by mass spectrometry. See lot specific certificate of analysis or vial label for 5mC content of each lot.ApplicationMethylated Control DNA has been used as a negative control in bisulfite sequencing of embryonic genomic DNA.Параметрыform liquid Quality Level 200, concentration 50 ng/μL color colorless storage temp. −20°C
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MgCl2 Stock Solution 11699113001
General descriptionThe MgCl2 Stock Solution is used for the individual adjustment of the Mg2+-concentration in the PCR reaction and can be used in combination with the PCR buffer without MgCl2. In most applications a concentration of 1.5mM MgCl2 will yield satisfactory results with a dNTP concentration of 200µM each. In many cases, however, it is required to titrate the optimal Mg2+ concentration to increase the specificity and the yield of the PCR reaction.ApplicationThe combination of PCR Buffer without MgCl2 and the MgCl2 Stock Solution buffer are optimized for the amplification of specific DNA fragments in conventional PCRs (i.e., with Taq DNA Polymerase). However, the MgCl2 Stock Solution may be used with other, more appropriate PCR buffers to optimize any type of PCR (e.g., hot start PCR, high fidelity PCR, long template PCR).
Biochem/physiol Actions
Magnesium (Mg2+) chelates nucleotide triphosphates (dNTPs) and its usage is one among the optimization strategies for polymerase chain reaction (PCR). It promotes orthophosphate synthesis from oligophosphates by stabilizing the phosphate groups of nucleotides.
Physical form
The MgCl2 Stock Solution contains 25mM MgCl2 in sterile water.Other NotesFor life science research only. Not for use in diagnostic procedures.Параметрыform solution Quality Level 100, packaging pkg of 3 x 1 mL Торговая марка Roche concentration 25 mM shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany nwg Flash Point F does not flash Flash Point C does not flash Узнать цену -
Mineral oil
CAS Number: 8042-47-5 EC Number: 232-455-8 MDL number: MFCD00131611 NACRES: NA.52
PackagingКат. номер M8662-5VL M8662-1VL
5 vials in poly bottleApplication- For routine PCR amplifications.
- Minimizes evaporation of reactions run in PCR instruments without heated lids.
Features and Benefits- Provided in a convenient 5 x 1.5 mL (1 vial) pack size
Параметрыgrade PCR Reagent Quality Level 100, form liquid packaging vial of 1.5 mL (Total volume 7.5 mL (5 vials)) application(s) PCR: suitable color colorless refractive index n20/D 1.467 (lit.) density 0.84 g/mL at 25 °C (lit.) foreign activity DNase, RNase, protease, none detected storage temp. room temp InChI key AEOVEGJBKQQFOP-DDVLFWKVSA-L
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves, RIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F No data available Flash Point C No data available Узнать цену -
MTP™ Taq DNA Polymerase
NACRES: NA.55
Кат. номер D7442-1500UN D7442-250UN D7442-50UN General descriptionMTP Taq DNA Polymerase is a recombinant thermostable enzyme from Thermus aquaticus expressed in E. coli and purified using a proprietary process to minimize levels of contaminating DNA. The enzyme has both 53 DNA polymerase and exonuclease activities, is 95 kDa by SDS-PAGE, and has no detectable endonuclease or 35 exonuclease activities. Each lot of MTP Taq undergoes strict quality control testing to ensure the absence of detectable levels of contaminating DNA.
Contaminating DNA present in most other polymerase preparations often preclude or obscure the accurate interpretation of results, especially when targeting conserved sequences, e.g., bacterial 16S rRNA region. Through Sigmas proprietary DNA removal methods and strict quality control standards, we can ensure the absence of the most commonly found contaminant DNA. Each lot of MTP Taq is assayed using PCR and primers specific to (1) the conserved region of bacterial 16S rRNA, (2) the Taq expression vector, and (3) the human -actin gene.
While MTP Taq ensures a high-quality, low contaminant DNA polymerase for reliable PCR amplification, DNA contaminants can be introduced into PCR through a number of other reagents. To further minimize the risk of contaminant DNA during PCR, we include 10x MTP Taq Buffer with each tube of MTP Taq DNA Polymerase. Each lot of 10x MTP Taq Buffer undergoes the same strict quality control testing as MTP Taq DNA polymerase to ensure the absence of contaminating DNA. To prevent false positive PCR results, only DNA-free reagents should be used in PCR reactions with MTP Taq DNA polymerase.ApplicationMTP™ Taq DNA Polymerase has been used:- for the amplification of bacterial 16S rRNA genes from purified DNA(33)
- bacterial genome analysis
- pathogen detection
MTP Taq DNA Polymerase is a recombinant thermostable enzyme from Thermus aquaticus expressed in E. coli and purified using a proprietary process that minimizes levels of contaminating DNA. The enzyme has 5-3 DNA polymerase and exonuclease activities, is approximately 95 kD by SDS-PAGE, and has no detectable endonuclease or 3-5 exonuclease activities. Contaminating DNA present in most other polymerase preparations often precludes or obscures the accurate interpretation of results, especially when targeting conserved sequences (e.g. bacterial 16S rRNA region).
While MTP Taq is a high-quality, low-contaminant DNA polymerase for reliable PCR amplification, DNA contaminants can be introduced into PCR through a number of other reagents. To further minimize the risk of contaminant DNA during PCR, we include 10x MTP Taq buffer (Sigma product M 9943) with each tube of MTP Taq DNA Polymerase. Each lot of MTP Taq and 10x MTP Taq buffer undergoes the same strict quality control testing to ensure the absence of contaminating DNA. To prevent false positive PCR results, only DNA-free reagents should be used in PCR reactions with MTP Taq DNA Polymerase.
Biochem/physiol Actions
MTP Taq polymerase catalyzes oligonucleotide primer-driven, DNA template dependent incorporation of dNTPs into complimentary DNA strands.
Features and Benefits
Low contaminant DNA polymerase
Prevents false positive PCR results from contaminating bacterial DNA
Components- MTP Taq DNA Polymerase (D7067)
- 10x MTP Taq Buffer (M9943)
Unit Definition
One unit incorporates 10 nmol of total deoxyribonucleoside triphosphates into acid precipitable DNA in 30 minutes at 74 °C.Other NotesStore at –20 °C. For convenience, 10x MTP Taq Buffer can be stored at room temperature.Legal InformationNo license is conveyed with the purchase of this product under any of US Patents Nos. 5,804,375, 5,994,056, 6,171,785, 6,214,979, 5,538,848, 5,723,591, 5,876,930, 6,030,787, and 6,258,569, and corresponding patents outside the United States, or any other patents or patent applications, relating to the 5′ Nuclease and dsDNA-Binding Dye Processes. For further information contact the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
MTP is a trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, form liquid feature hotstart: no concentration 5 unit/µL color colorless shipped in wet ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 2 Узнать цену -
MystiCq® microRNA cDNA Synthesis Mix
NACRES: NA.55
Кат. номер MIRRT-25RXN MIRRT-100RXN General descriptionStarting with total RNA or samples pre-enriched or microRNAs, the MystiCq microRNA cDNA Synthesis Mix kit contains all the components necessary to convert mature microRNAs into cDNA templates for qPCR. Since microRNAs are not naturally polyadenylated, the first step in the cDNA synthesis process is to polyadenylate the microRNAs through a poly(A) polymerase reaction. Next, the ReadyScript reverse transcriptase, an oligo-dT adapter primer and other required reagents are added to convert the polyadenylated microRNAs into cDNA. The adapter primer includes a unique sequence at the 5 end that is complementary to the sequence of the MystiCq Universal PCR Primer, another component of the MystiCq microRNA qPCR Assay System.The kit also contains a Positive Control Primer that is specific to SNORD44, a small nucleolar RNA that is widely expressed in most human tissues. Sufficient amounts of the Poly(A) Tailing Buffer and the MicroRNA cDNA Reaction mix are included in the kit to allow for the use of no poly(a) polymerase and no reverse transcriptase control reactions. To analyze individual microRNAs, use the MystiCq Universal PCR Primer (which targets the adapter primer sequence) together with the MystiCq microRNA qPCR Assay Primer and the MystiCq microRNA SYBR Green qPCR ReadyMix.ApplicationMystiCq® microRNA cDNA Synthesis Mix has been used for the quantitation of micro RNA-quantitative real time PCR (qRT-PCR).
Features and Benefits- Separate polyadenylation and reverse transcription steps allow for the possibility of optimization of protocol if necessary
- cDNA produced may be archived for future use
- Single RT reaction can provide up to 1000 qPCR reactions
- Includes a positive control primer for use with most human tissues
Packaging
Default reaction volume is 20 μLLegal InformationMystiCq is a registered trademark of Qiagen Beverly Inc.Параметрыshipped in wet ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport Узнать цену -
MystiCq® microRNA qPCR Assay Primer MIRAP00047-250RXN
miRNA ID: hsa-miR-21-5p Sanger Database NACRES: NA.55 General descriptionThe MystiCq microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.
Features and Benefits
Features and Benefits- Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
- Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
- No self-complementarity or primer dimer artifacts with the Universal PCR Primer
- Optimized primer Tm designed to match the Universal PCR Primer
- Universal cycling conditions ensures robust amplification for all assays in profiling experiments
- Optimized PCR product Tm (75-78° C)
Other NotesFormerly hsa-miR-21. Compatible with mmu-miR-21 and rno-miR-21.Legal InformationMystiCq is a registered trademark of Qiagen Beverly Inc.Параметрыform liquid concentration 10 mg/mL mature sequence UAGCUUAUCAGACUGAUGUUGA mp ~77 °C Sanger mature/minor accession no. MIMAT0000076, shipped in wet ice storage temp. 20°C Gene Information human ... MIR21(406991)
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MystiCq® microRNA qPCR Control Primer MIRCP00001-250RXN
miRNA ID: RNU6-1 Sanger Database NACRES: NA.55 General descriptionThe MystiCq microRNA qPCR Control Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific small RNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix.ApplicationU6 small nuclear 1 (RNU6-1) gene primer has been used as a positive control for qPCR.
Features and Benefits
Features and Benefits- Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
- Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
- No self-complementarity or primer dimer artifacts with the Universal PCR Primer
- Optimized primer Tm designed to match the Universal PCR Primer
- Universal cycling conditions ensures robust amplification for all assays in profiling experiments
- Optimized PCR product Tm (75-78° C)
Other NotesDetects RNU6-1 and RNU6-2. Compatible with mouse and rat.Legal InformationGenBank is a registered trademark of United States Department of Health and Human Services
MystiCq is a registered trademark of Qiagen Beverly Inc.Параметрыform liquid mature sequence GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU mp ~76.5 °C GenBank® mature/minor accession no. NR_004394.1, shipped in wet ice storage temp. 20°C Gene Information human ... RNU6-1(26827)
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MystiCq® microRNA® SYBR® Green qPCR ReadyMix™
NACRES: NA.55
Кат. номер MIRRM03-100RXN MIRRM03-2000RXN MIRRM03-SAMPLE MIRRM03-2000RXN-PW MIRRM03-500RXN General descriptionThe MystiCq microRNA SYBR Green qPCR ReadyMix is one of the integral components of the MystiCq microRNA qPCR Assay System. This ReadyMix is a specially-formulated 2X concentrate with an antibody-based hot-start Taq DNA polymerase and all the optimized components needed for highly specific, reliable, and reproducible microRNA qPCR assays. Simply add the specific MystiCq microRNA qPCR Assay Primer, the MystiCq Universal PCR primer, and cDNA template generated by the MystiCq microRNA cDNA Synthesis Kit and you′re ready to go. Because there are different methods used for fluorescent normalization on different real-time PCR instruments, there is a MystiCq microRNA SYBR Green qPCR ReadyMix available for your platform.ApplicationMystiCq microRNA SYBR Green qPCR ReadyMix, iQ™, is compatible with the following platforms: Biorad iCycler iQ, BioRad iQ5, BioRad MyiQ™.
Features and Benefits- Exclusively for use with the MystiCq microRNA qPCR Assay Primers, Control Primers, and Universal PCR primer
- 2X concentrated for easy reaction setup with hot-start Taq, dNTPs and optimized buffer
- Passive reference dye (if required) included at the optimal concentration
Packaging
Default reaction volume is 50 µL
100RXN is packaged as 2 X 1.25 mL
500RXN is packaged as 10 X 1.25 mL
2000RXN is packaged as 1 X 50 mLLegal InformationMyiQ is a trademark of Bio-Rad Laboratories, Inc.
MystiCq is a registered trademark of Qiagen Beverly Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies
iQ is a trademark of Bio-Rad Laboratories, Inc.Параметрыstorage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MystiCq® Universal PCR Primer MIRUP-500RXN
NACRES: NA.55 General descriptionThe MystiCq Universal PCR primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to work specifically with the MystiCq microRNA qPCR Assay primers and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.ApplicationMystiCq® Universal PCR Primer has been used for the quantitation of microRNA.Legal InformationMystiCq is a registered trademark of Qiagen Beverly Inc.Параметрыform liquid concentration 10 mg/mL shipped in wet ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
Neutralization Solution for Blood
NACRES: NA.25
Кат. номер N9784-200ML N9784-1.5ML N9784-250ML N9660-1VL-PW N9784-1.5ML-PW N9784-200ML-PW N9784-20ML-PW N9784-250ML-PW N9784-1.5ML-KC N9784-200ML-KC N9784-20ML-KC N9784-250ML-KC N9784-PH N9784-25ML-KC N9784-25ML N9784-20ML General descriptionThis neutralization solution is a component of the REDExtract-N-Amp™ Blood PCR Kits for the rapid extraction and amplification of human genomic DNA from whole blood, whole blood dried on a blood card, and cultured mammalian cells.Legal InformationREDExtract-N-Amp is a trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, grade for molecular biology form liquid storage temp. room temp
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
Oligo(dT)23, Anchored
NACRES: NA.52
PackagingКат. номер O4387-.1ML-KC O4387-.1ML
0.1 mL in poly bottleApplicationThe Anchored Oligo(dT)23 Primers have 23 thymidine residues and one G, C, or A residue (the anchor) at the 3 end. This anchor ensures the oligo(dT)23 primer binds at the beginning of the message such that there are no long regions of unusable sequence. Anchored oligo(dT)23 primers may provide an advantage over standard oligo(dT) primers when generating cDNA from poly(A)+ RNA.Параметрыusage 0.1 mL sufficient for 100 RT-PCR reactions (as described in the Technical Bulletin for Product Codes HSRT100 and HSRT20) Quality Level 200, concentration 70 µM in H2O color colorless shipped in wet ice storage temp. 20°C
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves, RIDADR NONH for all modes of transport WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
PCR Buffer Set 11699121001
General descriptionThe kit-provided PCR buffer without MgCl2, in combination with the kit-provided MgCl2 stock solution, are used for the individual adjustment of the Mg2+ concentration. In most PCR applications, a concentration of 1.5 mM MgCl2 will yield satisfactory results with a dNTP concentration of 200 µM for each nucleotide. To optimize the PCR, titrate to determine the optimal Mg2+ concentration for high PCR specificity and amplicon yield.ApplicationFor optimization of the magnesium-chloride concentration in the polymerase chain reaction (PCR) using Taq DNA Polymerase.
Packaging
1 set containing 2 components
1 set containing 3 components
Quality
Function test: Each lot of buffer is tested in PCR.
Absence of contaminants: No exo- or endonuclease activity is detectable according to the current Quality Control procedures.Other NotesFor life science research only. Not for use in diagnostic procedures.Параметрыpackaging pkg of 2 x 2 mL Quality Level 100, Торговая марка Roche shipped in dry ice storage temp. −20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F does not flash Flash Point C does not flash Узнать цену -
PCR Buffer Without MgCl2, 10x concentrated 11699105001
General descriptionThe PCR buffer without MgCl2, in combination with the MgCl2 stock solution, is used for the individual adjustment of the Mg2+ concentration in the PCR reaction. In most applications a concentration of 1.5mM MgCl2 will yield satisfactory results with a dNTP concentration of 200µM each. In many cases, however, it is required to titrate the optimal Mg2+ concentration to increase the specificity and yield of the PCR reaction.The buffer is ten-fold concentrated and should be used in combination with the MgCl2 stock solution.ApplicationThe PCR buffer without MgCl2 has been used for the amplification of specific DNA fragments by the polymerase chain reaction (PCR).
Physical form
Solution, 100 mM Tris-HCl, 500 mM KCl (pH 8.3 at 20 °C)Other NotesFor general laboratory use.Параметрыform solution Quality Level 100, packaging pkg of 3 x 1 mL Торговая марка Roche shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F does not flash Flash Point C does not flash Узнать цену -
PCR Core Kit 11578553001
General descriptionThe PCR Core Kit supplies all reagents (polymerase, buffers, dNTPs, etc.) for optimizing conventional PCRs of a specific template with maximum sensitivity, and specifcity. For convenience, each reagent component in the kit is supplied in a separate vial. This allows the user to easily change the amount of polymerase, dNTPs, and MgCl2 in the reaction mix. Most importantly, the kit allows easy optimization of the Mg2+ concentration, one of the most crucial variables in the PCR.ApplicationPrinciple
PCR is an in vitro method for enzymatically synthesizing defined sequences of DNA. The reaction uses two oligonucleotide primers that hybridize to opposite strands and flank the target DNA sequence to be amplified. A repetitive series of cycles involving template denaturation, primer annealing, and extension of the annealed primers by DNA polymerase results in the accumulation of a specific DNA fragment, the termini of which are defined by the 5-ends of the primers.
Because the primer extension products synthesized in a given cycle can serve as a template in the next cycle, the number of target DNA copies approximately doubles every cycle; thus, 20 cycles of PCR yield about a million copies (220) of the target DNA. Primer elongation is catalyzed by Taq DNA Polymerase, a heat-stable DNA polymerase isolated from the thermophilic eubacterium Thermus aquaticus BM.
The PCR Core Kit is designed to determine individual PCR conditions for all basic PCR applications relying on Taq DNA Polymerase. Assays which might give better sensitivity and specificity with a non-standard Mg-concentration in the reaction buffer can be optimized using the Mg-free buffer supplied with this kit.
Packaging
1 kit containing 5 components.
Quality
Each lot is PCR tested using λDNA. Each lot is also tested for the absence of exo- and endonucleases, and nicking activities according to the current Quality Control procedures.Other NotesFor life science research only. Not for use in diagnostic procedures.
Contents
- Taq DNA Polymerase, 250 U, 5 U/µl in storage buffer: 20 mM Tris-HCl, 100 mM dithiothreitol, 0.1 mM EDTA, 0.5% Nonidet P40 (v/v), 0.5% Tween 20 (v/v), 50% glycerol (v/v), pH 8.0 (+4°C)
- dNTP stock solution, 200 µl, containing each 10 mM dATP, dCTP, dGTP, dTTP, in sterile double-distilled water, pH 7.0
- PCR reaction buffer, 10x concentrated, 2 x 1 ml, 100 mM Tris-HCl, 15 mM MgCl2, 500 mM KCl, pH 8.3 (+20°C)
- 25 mM MgCl2 stock solution, 1 ml
- PCR reaction buffer without MgCl2, 10x concentrated, 1 ml, 100 mM Tris-HCl, 500 mM KCl, pH 8.3 (+20°C)
Legal InformationUse of this product is covered by US Patent No. 6,127,155 and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Human and veterinary diagnostic uses under Roche patent claims require a separate license from Roche. All uses other than internal research and human and veterinary diagnostic uses under Roche patent claims require a separate license from Thermo Fisher Scientific. Further information on purchasing licenses from Roche may be obtained by contacting the Licensing Department of Roche Molecular Systems, Inc., 4300 Hacienda Drive, Pleasanton, California 94588, USA or Roche Diagnostics GmbH, Sandhofer Strasse 116, 68305 Mannheim, Germany. Further information on purchasing licenses from Thermo Fisher Scientific may be obtained by contacting the Licensing Department of Thermo Fisher Scientific, 5791 Van Allen Way, Carlsbad, California 92008, USA.ПараметрыQuality Level 100, usage sufficient for ≤100 reactions Торговая марка Roche parameter 72 °C optimum reaction temp. optimum pH ~9.0 (20 °C) shipped in dry ice storage temp. −20°C
Safety Informationhcodes H412 pcodes P273 - P501 RIDADR NONH for all modes of transport WGK Germany WGK 2 Flash Point F does not flash Flash Point C does not flash Узнать цену -
PCR Core kit with Taq DNA polymerase CORET-1KT
eCl@ss: 32161000 NACRES: NA.55 ApplicationThis kit contains all the reagents necessary to amplify genomic DNA, cDNA, or cloned DNA templates. Each component has been tested in the Polymerase Chain Reaction. Optimal concentrations of Taq polymerase, template DNA, primers, and MgCl2 will depend on the specifics of the system. It may be necessary to optimize each component separately, especially the Taq and Mg2+ concentrations and the cycling parameters.
Quantity
Kit contains enough reagents for 250 units of Taq DNA polymerase.Other NotesThe following reagents are required but not provided in the kit:- Mineral Oil, M 8662 (optional)
- Thermocycler
- Primers
- DNA to be amplified
- Chloroform, C 7559 (optional)
Legal InformationNo license is conveyed with the purchase of this product under any of US Patents Nos. 5,804,375, 5,994,056, 6,171,785, 6,214,979, 5,538,848, 5,723,591, 5,876,930, 6,030,787, and 6,258,569, and corresponding patents outside the United States, or any other patents or patent applications, relating to the 5′ Nuclease and dsDNA-Binding Dye Processes. For further information contact the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.ПараметрыQuality Level 200, form liquid feature hotstart: no color colorless shipped in wet ice storage temp. −20°C
Safety InformationRIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
PCR Core KitPLUS 11585541001
General descriptionThe PCR Core KitPLUS supplies all basic reagents to perform a polymerase chain reaction with the exception of template DNA and appropriate primers. The kit uses Taq DNA Polymerase as the polymerase. In addition UNG, heat-labile is supplied in the kit for efficient degradation of contaminating DNA from previous PCR amplifications.ApplicationThe PCR Core KitPLUS is the solution for laboratories that have to run PCRs with non-standard reaction conditions and also have to make sure that samples are not contaminated with DNA from earlier amplification reactions.
Features and Benefits
The PCR Core KitPLUS is from Thermus aquaticus BM , expressed in E. coli . This highly processive 5 3 DNA polymerase lacks 3 5 exonuclease activity. It is stable during prolonged elevated temperatures (+95°C). During PCR, it retains over 80% activity after 30 cycles (1 minute, +95°C; 1 minute, +37°C; 1 minute, +72°C). The thermostable enzyme is a single polypeptide chain with a molecular weight of approximately 95kD.- Reliable reproducible results:
- Flexible:
- Optimize Mg2+:
- Eliminate false-positive results:
Packaging
1 kit containing 6 components.
Quality
Each lot is PCR tested using λDNA. Each lot is also tested for the absence of exo- and endonucleases, and nicking activities according to the current Quality Control procedures.
Specifications
The PCR Core KitPLUS can reduce the risk of false-positive results by perventing PCR carryover contamination. Supplied Uracil-DNA Glycosylase (UNG) catalyzes the removal of uracil from single- and double-stranded DNA originating from the incorporation of dUTP during DNA replication or deamination of cytosine. The abasic sites are susceptible to cleavage by heat under alkaline conditions. Ribouracil residues in RNA and dUTP are not substrates for UNG. Using this kit can eliminate preexisting PCR products by at least a factor of 107.Other NotesFor life science research only. Not for use in diagnostic procedures.Legal InformationUse of this product is covered by US patent claims and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim, no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patent claims require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.</ br>NOTICE TO PURCHASER: LIMITED LICENSE<br />Use of this product is covered by US Patent No. 6,127,155 and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Human and veterinary diagnostic uses under Roche patent claims require a separate license from Roche. All uses other than internal research and human and veterinary diagnostic uses under Roche patent claims require a separate license from Thermo Fisher Scientific. Further information on purchasing licenses from Roche may be obtained by contacting the Licensing Department of Roche Molecular Systems, Inc., 4300 Hacienda Drive, Pleasanton, California 94588, USA or Roche Diagnostics GmbH, Sandhofer Strasse 116, 68305 Mannheim, Germany. Further information on purchasing licenses from Thermo Fisher Scientific may be obtained by contacting the Licensing Department of Thermo Fisher Scientific, 5791 Van Allen Way, Carlsbad, California 92008, USA.Параметрыusage sufficient for 50 reactions Quality Level 100, Торговая марка Roche parameter 72 °C optimum reaction temp. optimum pH ~9.0 (20 °C) shipped in dry ice storage temp. 20°C
Safety Informationhcodes H412 pcodes P273 - P501 RIDADR NONH for all modes of transport WGK Germany WGK 2 Flash Point F does not flash Flash Point C does not flash Узнать цену -
PCR Master 11636103001
General descriptionThe PCR Master contains all the reagents required to perform a standard PCR. All that must be added is the template DNA, the primers, and the required amount of water. The PCR Master contains a fixed MgCl2 concentration of 1.5 mM. However, higher concentrations may be achieved by adding additional MgCl2. PCR products generated by PCR Master are 3-A single-overhang products. Therefore T/A cloning can be applied.
The PCR Master is stable at +2 to +8 °C, allowing immediate PCR without the time-consuming thawing of reagents.
Routine assays have medium size amplicons and 50% GC content. Taq DNA Polymerase has no proofreading or hot start features. It is optimally active at +75°C and pH 9. The 5 3 DNA polymerase lacks 3 5 exonuclease activity. The thermostable enzyme is a single polypeptide chain with a molecular weight of approximately 95 kD.
Lack of restriction endonuclease:
The enzyme originally isolated from T. aquaticus BM lacks Taq I restriction endonuclease activity.ApplicationThe PCR Master can be used instead of the single reagent Taq DNA Polmerase, or instead of the PCR Core Kit for nearly all simple, routine polymerase chain reaction applications. The only limitation is that the sample volume must not exceed half the total reaction volume. The PCR master mix is used for:- Routine PCR
- RT-PCR
- Other primer-extension reactions, such as sequencing and labeling
Features and Benefits- Reliable reproducible results:
- Convenience:
- Prevent PCR carryover:
- Ready for immediate use:
Packaging
1 kit containing 2 components.
Quality
Each lot is PCR tested using λDNA. Each lot is also tested for the absence of exo- and endonucleases, and nicking activities according to the current Quality Control procedures.Other NotesFor life science research only. Not for use in diagnostic procedures.Legal InformationUse of this product is covered by US patent claims and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim, no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patent claims require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.</ br>NOTICE TO PURCHASER: LIMITED LICENSE<br />Use of this product is covered by US Patent No. 6,127,155 and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Human and veterinary diagnostic uses under Roche patent claims require a separate license from Roche. All uses other than internal research and human and veterinary diagnostic uses under Roche patent claims require a separate license from Thermo Fisher Scientific. Further information on purchasing licenses from Roche may be obtained by contacting the Licensing Department of Roche Molecular Systems, Inc., 4300 Hacienda Drive, Pleasanton, California 94588, USA or Roche Diagnostics GmbH, Sandhofer Strasse 116, 68305 Mannheim, Germany. Further information on purchasing licenses from Thermo Fisher Scientific may be obtained by contacting the Licensing Department of Thermo Fisher Scientific, 5791 Van Allen Way, Carlsbad, California 92008, USA.Параметрыusage sufficient for 200 reactions, (50 μl final reaction volume each containing 2.5 U Taq DNA-Polymerase) Quality Level 100, feature dNTPs included, hotstart: no Торговая марка Roche application(s) PCR: suitable input purified DNA shipped in dry ice storage temp. −20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F does not flash Flash Point C does not flash Узнать цену -
PCR Nucleotide Mix
Кат. номер 11581295001 4638956001 11814362001 General descriptionPCR Nucleotide Mix is a clear, colorless solution of the sodium salts of dATP, dCTP, dGTP, and dTTP, each at a concentration of 10 mM in Water, PCR Grade. This nucleotide mixture can be added directly to polymerase chain reactions.Application- The PCR Nucleotide Mix is optimized for use in all types of amplification reactions and primer-extension reactions: PCR
- RT-PCR
- cDNA synthesis
- Primer extension
Features and Benefits
The PCR Nucleotide Mix can be added directly to amplification reactions. PCR Grade nucleotides from Roche are specially manufactured and purified to the highest possible chemical purity.
Improve yield and performance- Choose a convenient ready-to-use mix of all 4 nucleotides.
- Achieve the highest PCR and RT-PCR sensitivity.
- Insist on highest purity (>99%) nucleotides.
Packaging
1 set containing 4 ready-to-use mixes
Quality
Function Testing in PCR
Function Testing in RT-PCR
Absence of Contaminating Deoxyribonucleases/Nicking Activities according to the current Quality Control procedures.
Absence of Contaminating Ribonucleases according to the current Quality Control procedures.
Preparation Note
Activator: Mg2+
Working solution: If required, the solutions can be diluted with distilled autoclaved water.
Storage conditions (working solution): It will withstand 50 freeze/thaw cycles.Other NotesFor life science research only. Not for use in diagnostic procedures.Параметрыform solution Quality Level 100, usage sufficient for 2,500 reactions (04638956001), sufficient for 5,000 reactions (11814362001), sufficient for 500 reactions (11581295001) packaging pkg of 10 x 200 μL (11814362001 [10mM, each]), pkg of 200 μL (11581295001 [10 mM, each]), pkg of 5 x 200 μL (04638956001 [10 mM, each]) Торговая марка Roche shipped in dry ice storage temp. −20°C
Safety InformationRIDADR NONH for all modes of transport Узнать цену -
PCR Nucleotide MixPLUS 11888412001
General descriptionPCR Nucleotide MixPLUS is a clear, colorless solution of the sodium salts of dATP, dCTP, dGTP, each at a concentration of 10 mM, and dUTP at a concentration of 30 mM in Water, PCR Grade. This nucleotide mixture can be added directly to polymerase chain reactions.
The incorporation of dUTP in place of dTTP allows the degradation of contaminating PCR products from former reactions with Uracil-DNA Glycosylase (UNG) to prevent carryover contamination from previous amplifications.Application- This ready-to-use nucleotide mix is a premixed solution of the sodium salts of dATP, dGTP, and dCTP, each at a concentration of 10 mM, and dUTP at a concentration of 30 mM in water. This mix is optimized for use in all types of amplification reactions: PCR
- RT-PCR
- Prevention of carryover contamination
It has been used in LightCycler PCR assay to identify B. pertussis and B.parapertussis in nasopharyngeal swabs. It has also been used in quantitative PCR (qPCR) assay.
Features and Benefits
The PCR Nucleotide MixPLUS can be added directly to amplification reactions.PCR Grade nucleotides from Roche are specially manufactured and purified to the highest possible chemical purity. They can be used to amplify even low amounts of template RNA and DNA.
Improve yield and performance- Choose a convenient ready-to-use mix of all 4 nucleotides.
- Achieve the highest PCR and RT-PCR sensitivity.
- Insist on highest purity (>99%) nucleotides
Packaging
1 set containing 4 ready-to-use mixes
Quality
Function tested in PCR to ensure specific DNA amplification. Decontamination with UNG is verified. No RNases or DNases are detectable according to the current Quality Control procedures.Other NotesFor life science research only. Not for use in diagnostic procedures.Параметрыform solution Quality Level 100, usage sufficient for 500 reactions packaging pkg of 2 x 100 µL (10 mM each) Торговая марка Roche shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F does not flash Flash Point C does not flash Узнать цену -
Primer for cDNA Synthesis 10814270001
General descriptionThis primer consists of a 15-mer oligonucleotide that shows thymidine (T) at each individual position. The oligonucleotides are HPLC purified, desalted, and supplied as a lyophilizate of the Li-salt. The p(dT)15 primer is not phosphorylated at the 5 end.Oligo(dT)N generates full-length cDNAs. If template contains oligo(A) stretches internally, the primer may bind these, causing mis priming and transcripts that are not full-length.
Composition: p(dT)15[ 15-mer oligonucleotide containing only deoxythymidine (dT) residues].
Phosphorylation: The p(dT)15 primer is not phosphorylated at the 5 end.ApplicationPrimer for cDNA synthesis may be used in:- RT-PCR
- Generation of cDNA libraries
- Synthesis of first-strand cDNA
Unit Definition
8 nmol 1 A260 unitOther NotesFor life science research only. Not for use in diagnostic procedures.ПараметрыQuality Level 100, form lyophilized packaging pkg of 40 μg Торговая марка Roche shipped in dry ice storage temp. −20°C (−15°C to −25°C)
Safety InformationRIDADR NONH for all modes of transport Flash Point F does not flash Flash Point C does not flash Узнать цену -
Protector RNase Inhibitor
Кат. номер 3335402001 3335399001 General descriptionProtector RNase Inhibitor inactivates a wide spectrum of RNases, including- RNase A
- RNase B
- RNase T2
- protect mRNA during cDNA synthesis reactions, RT-PCR (in conventional thermal cyclers and qPCR systems), or in vitro transcription/translation reactions
- protect viral RNA during in vitro virus replication
- inhibit RNases during RNA isolation and purification
- be used in RNase protection assays
- help prepare RNase-free antibodies
Contents
Protector RNase Inhibitor (40 U/µl) in storage buffer: 20 mM HEPES-KOH, 50 mM KCl, 8 mM dithiothreitol, 50% glycerol (v/v), pH approximately 7.6 (+4°C).SpecificityProtector RNase Inhibitor definetely does not inhibit RNase T1 and RNase 1.
Protector RNase Inhibitor (20 U/ 20 µl reaction) inhibits RNase A up to 1 ng, RNase B up to 160 pg and RNase T2 up to 0.03 U/µl reaction volume.
RNase H is not inhibited by Protector RNase Inhibitor.
Heat inactivation: > 65 °CApplicationProtector RNase Inhibitor may be used to:- Protect mRNA in cDNA synthesis reactions, RT-PCR (in conventional thermal cyclers and qPCR systems), e.g., with the LightCycler® Instruments, in vitro transcription/translation system, RNase Protection Assay, in vitro RNA synthesis
- Protect viral RNA during in vitro virus replication
- Inhibit RNases during RNA isolation and purification
- Help prepare RNase-free antibodies
- Synthesize RNA probes for in situ hybridization
Features and Benefits- Rely on a thermostable RNase inhibitor: Protector RNase Inhibitor remains stable even when using thermostable reverse transcriptases such as Transcriptor Reverse Transcriptase.
- Benefit from a wide range of reaction conditions: Protector RNase Inhibitor is active at pH 5.0 to 9.0 and at temperatures between +25°C to +55°C (partial activity is still measureable at +60°C).
- Eliminate interference in different RNA analysis applications: Maintain performance even when adding at 16-fold higher than the standard concentration.
- Insist on a highly-purified preparation: Each batch is function tested using techniques such as quantitative RT-PCR to ensure the absence of endonucleases, ribonucleases, or nicking activity, according to the current quality control procedures.
QualityEach lot of Protector RNase Inhibitor is function tested with the Titan One Tube RT-PCR Kit and the LightCycler DPD Kit. Protector RNase Inhibitor is also tested for contaminating activities as described below.
Test buffer: 50 mM Tris-HCl, 10 mM MgCl2, 0.1 mM EDTA, 7 mM -Mercaptoethanol; pH 7.5 (+37°C).
Absence of endonucleases: 1 µg EcoR I/Hind III*-fragments of DNA is incubated with Protector RNase Inhibitor in 50 µl test buffer at +37°C for 1 hour. The amount of inhibitor that causes no alteration in the banding pattern is stated under "Endo".
Absence of nicking activity: 1 µg supercoiled pBR322 DNA is incubated with Protector RNase Inhibitor in 50 µl test buffer at +37°C for 1 hour. The amount of inhibitor that causes no relaxation of supercoiled DNA is stated under "Nick. Act.".
Absence of ribonuclease (1): 5 µg of MS2 RNA is incubated with Protector RNase Inhibitor for 1 hour at +37°C in a final volume of 50 µl. The amount of inhibitor that causes no degradation of MS2 RNA is stated under "RNase 1".
Absence of ribonuclease (2): 5 µg of MS2 RNA is incubated with Protector RNase Inhibitor for 1 hour at +37°C, then 10 minutes at +65°C in a final volume of 50 µl. The amount of inhibitor that causes no degradation of MS2 RNA is stated under "RNase 2".Unit DefinitionOne unit of Protector RNase Inhibitor is defined as the amount of protein required to inhibit 50% of the activity of 5 ng RNase A.
Unit Assay: Activity is measured according to Blackburn as ability to inhibit hydrolysis of cyclic cytidine-2 : 3-monophosphoric acid. Under assay conditions, 200 U of Protector RNase Inhibitor inhibits 50% of the activity of 1 µg RNase A.
Volume Activity: 40 U/µlPreparation NoteWorking concentration:- 5 to 10 U in One-step RT-PCR
- 25 to 50 U in Two step RT-PCR
- 20 U for in vitro transcription
of inhibitor did not interfere with RT-PCR.)Other NotesProduct Specifications:
Source: Rat lung; Product is produced recombinant in E. coli
Isoelectric Point: pH 4.5
Temperature where Protector RNase Inhibitor is active: 25°C to +55°C; partial activity is still measurable at +60°C
Inactivation: Under severe denaturizing conditions (temperatures above +65°C), the inhibitor is inactivated
Bioburden: <50 cfu/ml
DNA Content: <100 pg/mg
For life science research only. Not for use in diagnostic procedures.Legal InformationNOTICE TO PURCHASER: DISCLAIMER OF LICENSE
This product is optimized for use in the polymerase chain reaction (PCR) covered by patents owned by F. Hoffmann-La Roche Ltd ("Roche"). No license under these patents to use the PCR Process is conveyed expressly or by implication to the purchaser by the purchase of this product. A license to use the PCR Process for certain research and development activities accompanies the purchase of certain Roche, Applied Biosystems or other licensed suppliers reagents when used in conjunction with an authorized thermal cycler, or is available from Applied Biosystems. Diagnostic purposes require a license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing at Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
LightCycler is a registered trademark of RocheПараметрыQuality Level 100 assay >95% (SDS-PAGE) mol wt ~50 kDa packaging pkg of 10,000 U (03335402001 5 x 2,000 U), pkg of 2,000 U (03335399001) mfr. no. Roche parameter 25-55 °C optimum reaction temp. pH range 5.0 - 9.0 shipped in dry ice storage temp. −20°C
Safety Information
