PCR &amp; Amplification

KAPA2G Fast HotStart® PCR Kit has been used in:

Routine PCR
Fast PCR
Genotyping

Biochem/physiol Actions
DNA fragments generated with KAPA2G Fast DNA Polymerase may be used for routine downstream analyses or applications, including restriction enzyme digestion, cloning and sequencing. Like wild-type Taq, KAPA2G Fast has 53 polymerase and 53 exonuclease activities, but no 35 exonuclease (proofreading) activity. The fidelity of KAPA2G Fast is similar to that of wild-type Taq; it has an error rate of approximately 1 error per 1.7 x 105 nucleotides incorporated.
Features and Benefits
Reduce cycling times up to 75% :

Extension times as low as 1 sec per kilobase
Broad coverage of both AT- and GC-rich targets

High speed, higher performance :

Single copy sensitivity from complex targets
Increased yields

Quick Notes:

KAPA2G Fast HotStart PCR Kits with dNTPs & Mg-free buffers contain the engineered KAPA2G Fast HotStart DNA Polymerase, developed for fast PCR.
Use 1 sec extension time for amplicons <1 kb and 15 sec/kb for longer amplicons, and save 20–70% of total reaction time.
No need for specialized instrumentation or PCR consumables.
Optimized buffer system offers improved yields,specificity and sensitivity, facilitating efficient primerannealing across a wide range of primer lengths,GC contents, and melting temperatures.
Use 0.5 U KAPA2G Fast HotStart DNA Polymerase per 25 µL reaction, or less for smaller volumes.
For high reaction efficiency, do not exceed 25 µL reaction volumes.
The buffer is available with and without MgCl2 KAPA2G Buffer A contains 1.5 mM MgCl2 at 1X, while KAPA2G Buffer M is Mg-free. Aside from MgCl2 content, these two buffers are identical.
Reaction products are 3-dA-tailed and may be cloned into TA cloning vectors.

Quality
Each batch of KAPA2G Fast DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230 Assay). KAPA2G Fast Ready Mix is subjected to stringent quality control tests, is free of contaminating exo- and endonuclease activity, and meets strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage. Provided that all components have been handled carefully and not contaminated, the kit is not expected to be compromised if left (unintentionally) at room temperature for a short period of time (up to 3 days). Long-term storage at room temperature and 4°C is not recommended. Please note that reagents stored at temperatures above -20°C are more prone to degradation when contaminated during use, and therefore storage at such temperatures is at the users own risk.

For Research Use Only. Not for use in diagnostic procedures.

HOTSTART is a registered trademark of Molecular BioProducts, Inc.

Quality Level	100,
shelf life	18 mo.
feature	Fast PCR, dNTPs included, hotstart
packaging	pkg of 250 U (KK5512), pkg of 500 U (KK5510)
Торговая марка	Roche
application(s)	PCR: suitable
input	purified DNA
shipped in	dry ice
storage temp.	20°C

KAPA2G Fast HotStart® ReadyMix™ has been used for:

pictograms	GHS07,GHS08
signalword	Warning
hcodes	H302 - H371 - H412
pcodes	P260 - P264 - P270 - P273 - P308 + P311 - P501
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KAPA2G Fast HotStart ReadyMix

Routine PCR
Fast PCR
Reverse transcription polymerase chain reaction (RT-PCR)
Genotyping and fluorescent PCR

Biochem/physiol Actions
KAPA2G Fast HotStart® DNA Polymerase generated DNA fragments may be used for routine downstream analyses or applications, including restriction enzyme digestion, cloning, and sequencing. Like wild-type Taq, KAPA2G Fast has 53 polymerase and 53 exonuclease activities, but no 35 exonuclease (proofreading) activity. The fidelity of KAPA2G Fast is similar to that of wild-type Taq; it has an error rate of approximately 1 error per 1.7 x 105 nucleotides incorporated.
Features and Benefits
Reduce cycling times up to 75% :

Extension times as low as 1 sec per kilobase
Broad coverage of both AT- and GC-rich targets

High speed, higher performance :

Single copy sensitivity from complex targets
Increased yields

Quick Notes :

KAPA2G Fast HotStart ReadyMix PCR Kits contain the engineered KAPA2G Fast HotStart DNA Polymerase, developed for fast PCR.
Use 1 sec extension time for amplicons <1 kb and 15 sec/kb for longer amplicons, and save 20–70% of total reaction time.
No need for specialized instrumentation or PCR consumables.
Optimized buffer system offers improved yields, specificity and sensitivity, facilitating efficient primer annealing across a wide range of primer lengths, GC contents, and melting temperatures.
For high reaction efficiency, do not exceed 25 µL reaction volumes.
KAPA2G Fast HotStart ReadyMix contains 1.5 mM MgCl2 at 1X.
KAPA2G Fast HotStart ReadyMix with dye includes two inert tracking dyes to allow direct loading onto agarose gels.Reaction products are 3-dA-tailed and may be cloned into TA cloning vectors.

Quality
Each batch of KAPA2G Fast DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230 Assay). KAPA2G Fast ReadyMix is subjected to stringent quality control tests, is free of contaminating exo- and endonuclease activity, and meets strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage. Provided that all components have been handled carefully and not contaminated, the kit is not expected to be compromised if left (unintentionally) at room temperature for a short period of time (up to 3 days). Long-term storage at room temperature and 4°C is not recommended. Please note that reagents stored at temperatures above -20°C are more prone to degradation when contaminated during use, and therefore storage at such temperatures is at the users own risk.

For Research Use Only. Not for use in diagnostic procedures.

HOTSTART is a registered trademark of Molecular BioProducts, Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC

Quality Level	100,
shelf life	18 mo.
feature	Fast PCR, Multiplex PCR, dNTPs included, hotstart
packaging	kit of 1.25 mL (100 x 25 µL rxn; KK5603), kit of 6.25 mL (500 x 25 µL rxn; KK5601)
Торговая марка	Roche
concentration	2 x
application(s)	PCR: suitable
input	purified DNA
shipped in	dry ice
storage temp.	20°C

KAPA2G Fast DNA Polymerase is a second-generation (2G) enzyme engineered for higher processivity and speed, offering significantly faster extension rates than wild-type Taq polymerase. In addition to speed, KAPA2G Fast provides higher yields and sensitivity than competitor enzymes across a broad range of targets.
KAPA2G Fast ReadyMix™ PCR Kits are designed for fast PCR, in which total reaction times are 20–70% shorter than those of conventional PCR assays performed with wild-type Taq DNA polymerase. This can be achieved without sacrificing reaction performance, and does not require specialized PCR consumables or thermocyclers.

pictograms	GHS08
signalword	Warning
hcodes	H371
pcodes	P260 - P264 - P270 - P308 + P311 - P405 - P501
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KAPA2G Fast ReadyMix

KAPA2G Fast ReadyMix™ has been used in

Nested PCR (nPCR)
Routine PCR
Fast PCR
Genotyping

Biochem/physiol Actions
DNA fragments generated with KAPA2G Fast DNA Polymerase may be used for routine downstream analyses or applications, including restriction enzyme digestion, cloning and sequencing. The fidelity of KAPA2G Fast is similar to that of wild-type Taq; it has an error rate of approximately 1 error per 1.7 x 105 nucleotides. Like wild-type Taq, KAPA2G Fast has 53 polymerase and 53 exonuclease activities, but no 35 exonuclease (proofreading) activity.
Features and Benefits
Reduce cycling times up to 75%:

Extension times as low as 1 sec per kilobase
Broad coverage of both AT- and GC-rich targets

High speed, higher performance:

Single copy sensitivity from complex targets
Increased yields

Quick Notes:

KAPA2G Fast ReadyMix PCR Kits contain the engineered KAPA2G Fast DNA Polymerase, developed for fast PCR.
Use 1 sec extension time for amplicons <1 kb and 15 sec/kb for longer amplicons, and save 20–70% of total reaction time.
No need for specialized instrumentation or PCR consumables.
Optimized buffer system offers improved yields, specificity and sensitivity, facilitating efficient primerannealing across a wide range of primer lengths, GC contents, and melting temperatures.
For high reaction efficiency, do not exceed 25 µL reaction volumes.
KAPA2G Fast ReadyMix contains 1.5 mM MgCl2 at 1X.KAPA2G Fast ReadyMix includes two inert tracking dyes to allow direct loading onto agarose gels.
Reaction products are 3-dA-tailed and may be cloned into TA cloning vectors.

Quality
Each batch of KAPA2G Fast DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230Assay). KAPA2G Fast ReadyMix is subjected to stringent quality control tests, is free of contaminating exo- andendonuclease activity, and meets strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage. Provided that the ReadyMix hasbeen handled carefully and not contaminated, the kit is not expected to be compromised if left (unintentionally )at room temperature for a short period of time (up to 3 days). Long-term storage at room temperature and 4°Cis not recommended. Please note that reagents stored at temperatures above -20°C are more prone to degradationwhen contaminated during use, and therefore storage at such temperatures is at the users own risk.

For Research Use Only. Not for use in diagnostic procedures.

ReadyMix is a trademark of Sigma-Aldrich Co. LLC

Quality Level	100,
shelf life	≤18 mo.
feature	Fast PCR, dNTPs included, hotstart: no
packaging	kit of 1.25 mL (100 x 25 μL rxn; KK5101), kit of 25 mL (KK5103), kit of 6.25 mL (500 x 25 μL rxn; KK5102)
Торговая марка	Roche
concentration	2 x
application(s)	PCR: suitable
input	purified DNA
shipped in	dry ice
storage temp.	−20°C

The second-generation KAPA2G Robust DNA Polymerase evolves to solve inconsistent amplification across a broad range of amplicon types (GC- and AT-rich). This product enables higher processivity and specific activity, which translates to robust PCR performance, high sensitivity, and improved tolerance to common inhibitors. The high performance of the KAPA2G Robust DNA Polymerase is ideally suited for challenging PCR applications and difficult samples, eliminating the need for optimization using multiple enzymes and protocols.

pictograms	GHS08
signalword	Warning
hcodes	H371
pcodes	P260 - P264 - P270 - P308 + P311 - P405 - P501
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KAPA2G Robust HotStart PCR Kit

KAPA2G Robust HotStart® PCR Kit has been used for:

Amplification of GC- or AT-rich templates
Templates containing common PCR inhibitors e.g. salts, urea, SDS, or ethanol
Crude sample PCR e.g. buccal swabs, cultured mammalian, yeast, or bacterial cells
Colony PCR
qPCR
Nested polymerase chain reaction (PCR) amplification
Amplification of DNA targets in PCR
DNA amplification using conventional PCR
Routine PCR

Biochem/physiol Actions
DNA fragments created with KAPA2G Robust HotStart® DNA Polymerase have the same characteristics as DNA fragments generated with wild-type Taq DNA polymerase. It can be used for routine downstream applications, such as restriction enzyme digestion, cloning, and sequencing. Like wild-type Taq, KAPA2G Robust HotStart has 53 polymerase and 53 exonuclease activities, devoid of 35 exonuclease (proofreading) activity. The fidelity of KAPA2G Robust HotStart is similar to wild-type Taq. It shows an error rate of approximately 1 error per 1.7 x 105 nucleotides incorporated.
Features and Benefits
Efficient amplification of GC- and AT-rich targets

Robust performance across a wide range of GC- and AT-rich templates
Increased PCR success rates

Improved tolerance to common PCR inhibitors

Efficient amplification from crude samples
Higher yield and sensitivity per unit of enzyme

Unrivalled performance in colony PCR

Higher yields and improved consistency of PCR direct from E. coli and yeast cells

Quick Notes:

KAPA2G Robust HotStart® PCR Kits with dNTPs contain KAPA2G Robust HotStart DNA Polymerase, engineered for high processivity and inhibitor tolerance.
Both purified genomic DNA and crude samples (e.g. colony PCR) can be used as template.
Use 0.5 U of KAPA2G Robust HotStart DNA Polymerase per 25 µL reaction. More challenging PCRs (GCrich,crude sample) may require higher enzyme concentrations.
Use 15 sec/kb extension time per cycle, and increase to 30-60 sec/kb for difficult amplicons or templates.
KAPA2G Buffers contain 1.5 mM MgCl2 at 1X.
Additional MgCl2 may be added using the 25 mM MgCl2 solution provided in the kit.
KAPA2G Buffer A is optimized for high yield, specificity, and sensitivity.
KAPA2G Buffer B is recommended for inhibitorcontaminated template samples.
KAPA2G GC Buffer is recommended for GC-rich PCR (>70% GC).
KAPA Enhancer 1 can be used with KAPA2G Buffer A or B, particularly for GC-rich assays.
Reaction products are 3-dA-tailed and may be cloned into TA cloning vectors.

Quality
Each batch of KAPA2G Robust HotStart® DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230 Assay). KAPA2G Robust HotStart PCR Kits are subjected to stringent quality control tests, are free of contaminating exo- and endonuclease activity, and meet strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage. Provided that all components have been handled carefully and not contaminated, the kit is not expected to be compromised if left (unintentionally) at room temperature for a short period of time (up to 3 days). Long-term storage at room temperature and 4°C is not recommended. Please note that reagents stored at temperatures above -20°C are more prone to degradation when contaminated during use, and therefore storage at such temperatures is at the user′s own risk.

For Research Use Only. Not for use in diagnostic procedures.

HOTSTART is a registered trademark of Molecular BioProducts, Inc.

Quality Level	100,
shelf life	≤12 mo.
feature	Difficult Templates/Specialty Enzymes PCR, dNTPs included, hotstart
packaging	pkg of 100 U (KK5532), pkg of 250 U (KK5516), pkg of 500 U (KK5518)
Торговая марка	Roche
application(s)	PCR: suitable
input	crude DNA
shipped in	dry ice
storage temp.	−20°C

The second-generation KAPA2G Robust DNA Polymerase was evolved to solve inconsistent amplification across a broad range of amplicon types (GC- and AT-rich). KAPA2G Robust HotStart® ReadyMix™ enables higher processivity and specific activity, which translates to robust PCR performance, high sensitivity, and improved tolerance to common inhibitors. The high performance of the KAPA2G Robust DNA Polymerase is ideally suited for challenging PCR applications and difficult samples, eliminating the need for optimization using multiple enzymes and protocols.

pictograms	GHS07,GHS08
signalword	Warning
hcodes	H302 - H371 - H412
pcodes	P260 - P264 - P270 - P273 - P308 + P311 - P501
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KAPA2G Robust HotStart ReadyMix

KAPA2G Robust HotStart® ReadyMix™ has been used for the:

amplification of GC- or AT-rich templates
aplification of templates containing common polymerase chain reaction (PCR) inhibitors e.g. salts, urea, SDS, or ethanol
crude sample PCR e.g. buccal swabs, cultured mammalian, yeast, or bacterial cells
colony PCR
DNA extraction and amplification
mutation screening
methylation-specific PCR (MSP) amplification
genotyping-PCR
PCR-based sequencing

Biochem/physiol Actions
DNA fragments generated with KAPA2G Robust HotStart® DNA Polymerase have the same characteristics as DNA fragments generated with wild-type Taq DNA polymerase and may be used for routine downstream analyses or applications, including restriction enzyme digestion, cloning, and sequencing. Like wild-type Taq, KAPA2G Robust HotStart has 53 polymerase and 53 exonuclease activities, but no 35 exonuclease (proofreading) activity. The fidelity of KAPA2G Robust HotStart is similar to that of wild-type Taq; it has an error rate of approximately 1 error per 1.7 x 105 nucleotides incorporated. PCR products generated by KAPA2G Robust HotStart are 3-dA-tailed and may be cloned into TA cloning vectors.
Features and Benefits
Efficient amplification of GC- and AT-rich targets

Robust performance across a wide range of GC- and AT-rich templates
Increased PCR success rates

Improved tolerance to common PCR inhibitors

Efficient amplification from crude samples
Higher yield and sensitivity per unit of enzyme

Unrivalled performance in colony PCR

Higher yields and improved consistency of PCR direct from E. coli and yeast cells

Quick Notes:

KAPA2G Robust HotStart ReadyMix PCR Kits contain KAPA2G Robust DNA Polymerase, engineered for high processivity and inhibitor tolerance.
Both purified genomic DNA and crude samples (e.g. colony PCR) can be used as template.
Use 15 sec/kb extension time per cycle, and increase to 30-60 sec/kb for difficult amplicons or templates.
KAPA2G Robust HotStart ReadyMix contains 2 mM MgCl2 at 1X.
KAPA2G Robust HotStart ReadyMix with dye includes two inert tracking dyes to allow direct loading onto agarose gels.
KAPA2G Robust HotStart ReadyMix is ideal for single-protocol PCR, i.e. amplification of fragments varying from 25–65% GC, up to 1 kb in size, using a single reaction setup and cycling protocol.
Reaction products are 3-dA-tailed and may be cloned into TA cloning vectors.

Quality
Each batch of KAPA2G Robust HotStart DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230 Assay). KAPA2G Robust HotStart ReadyMix PCR Kits are subjected to stringent quality control tests, are free of contaminating exo- and endonuclease activity, and meet strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage. Provided that all components have been handled carefully and not contaminated, the kit is not expected to be compromised if left (unintentionally) at room temperature for a short period of time (up to 3 days). Long-term storage at room temperature and 4°C is not recommended. Please note that reagents stored at temperatures above -20°C are more prone to degradation when contaminated during use, and therefore storage at such temperatures is at the user′s own risk.

For Research Use Only. Not for use in diagnostic procedures.

HOTSTART is a registered trademark of Molecular BioProducts, Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC

shelf life	12 mo.
Quality Level	100,
feature	Difficult Templates/Specialty Enzymes PCR, dNTPs included, hotstart
packaging	kit of 1.25 mL (100 x 25 µL rxn; KK5701), kit of 6.25 mL (500 x 25 µL rxn; KK5702)
Торговая марка	Roche
concentration	2 x ( contains 2 mM MgCl₂ at 1x)
application(s)	PCR: suitable
input	crude DNA
shipped in	dry ice
storage temp.	20°C

KAPA3G Plant PCR Kits are designed for PCR of plant-derived DNA, using either purified DNA or DNA prepared by crude extraction methods (crude sample PCR). In addition, the KAPA3G Plant PCR Kit can be used to amplify DNA from plant material added directly to the PCR (direct PCR). The KAPA3G Plant PCR Kit contains KAPA3G DNA Polymerase, a novel, third-generation (3G) enzyme which was engineered via a process of directed evolution for improved tolerance to common plant-derived PCR inhibitors such as polyphenolics and polysaccharides.The KAPA3G Plant PCR Kits are optimized for fast and efficient amplification of plant DNA from crude samples, DNA-containing carry-over inhibitors from crude extraction methods, and purified DNA.
KAPA3G Plant DNA Polymerase is a blend of the engineered A-family KAPA3G DNA Polymerase and a modified B-family DNA Polymerase. The enzyme blend is combined with proprietary antibodies to inactivate the enzymes prior to the first denaturation step. The fidelity of the KAPA3G Plant DNA Polymerase is 4-10 times higher than that of wild-type Taq.

pictograms	GHS07,GHS08
signalword	Warning
hcodes	H302 - H371
pcodes	P260 - P264 - P270 - P301 + P312 + P330 - P308 + P311 - P501
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KAPA3G Plant PCR Kit

KAPA3G Plant PCR Kit has been used for:

Amplification of fragments up to 5 kb in size from purified plant DNA, extracted with commercial kits or cetyl trimethyl ammonium bromide (CTAB)-based methods
Direct polymerase chain reaction (PCR) from leaf discs, seed samples, and other plant tissue types
PCR from crude plant DNA extracts, prepared from leaf and/or seed material
amplification of 16SrRNA
an ultra-rapid real-time reverse transcriptase (RT)-PCR assay

Features and Benefits
Key features of the KAPA3G Plant PCR Kit include:

Fast PCR direct from plant tissues such as leaf discs, seeds and crude plant extracts.
Streamlined workflows for transgenic screening.
Improved PCR success rates and reproducibility.
Efficient amplification of long and difficult targets from all sample types.

Amplify long targets from crude samples and purified DNA:

Amplify fragments up to 5 kb from purified DNA and crude samples
High yield and specificity with purified DNA and crude samples

Perform direct PCR from a variety of plant species and tissue types:

Direct PCR with leaf disc or seed as template
No need for time-consuming DNA extractions

Streamline workflows and improve turnaround times:

Perform PCR in half the time compared with wild-type enzymes
Eliminate the need for time-consuming

DNA extractions Improve success rates with novel crude sample plant PCR workflow:

Use extraction buffer to prepare crude extracts for plant PCR in just 5 minutes
High success rates with even the most challenging sample types

Quick Notes:

KAPA3G Plant DNA Polymerase is tolerant to plant-derived PCR inhibitors, and can amplify frompurified DNA, crude extracts, and plant material.
Optimize reaction conditions using purified DNA before attempting direct or crude sample PCR.
For direct PCR, use a sampling tool to control the amount of plant material added to the reaction. The use of excessive amounts of crude plant material in PCR is a major cause of direct PCR reaction failure.
For crude sample PCR, prepare a crude DNA extract using a small amount of plant material in Extraction Buffer (Refer to Section 3: Crude sample PCR), and use 1 µL per 50 µL reaction.
KAPA Plant PCR Buffer contains MgCl2 (1.5 mM at 1X) and dNTPs (0.2 mM each at 1X). Additional MgCl2(25 mM) is supplied separately for optimization.

Quality
Each batch of KAPA3G Plant DNA Polymerase is confirmed to contain <2% contaminating protein (Agilent Protein 230 Assay). KAPA3G Plant PCR Kits are subjected to stringent quality control tests, are free of contaminating exo- and endonuclease activity, and meet strict requirements with respect to DNA contamination levels.
Preparation Note
Always ensure that the product has been fully thawed and mixed before use. Reagents may be stored at 4°C for short-term use (up to 1 month). Return to -20°C for long-term storage.

For Research Use Only. Not for use in diagnostic procedures.

Quality Level	100,
usage	50 μL sufficient for 250 reactions (KK7251), 50 μL sufficient for 500 reactions (KK7252)
shelf life	≤12 mo.
feature	Difficult Templates/Specialty Enzymes PCR, dNTPs included: no, hotstart: no
Торговая марка	Roche
application(s)	PCR: suitable
input	crude DNA
shipped in	dry ice
storage temp.	−20°C

KiCqStart SYBR Green qPCR ReadyMix is a 2X concentrated, ready-to-use reaction cocktail that contains all components, except primers and template, for real-time quantitative PCR (qPCR) This unique combination of proprietary buffer, stabilizers, and Hot-Start Taq DNA polymerase delivers maximum PCR efficiency, sensitivity, specificity and robust fluorescent signal using fast, or conventional, cycling protocols with SYBR Green qPCR.
Highly specific amplification is crucial to successful qPCR with SYBR Green I dye technology because this dye binds to and detects any dsDNA generated during amplification. Hot-Start Taq DNA polymerase is antibody mediated to be inactive prior to the initial PCR denaturation step. The optimized formulation includes SYBR Green I dye, an antibody-mediated Hot-Start Taq DNA polymerase, dNPTs, MgCl2 and proprietary buffers and stabilizers.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

KiCqStart® SYBR® Green qPCR ReadyMix™

Instrument Compatibility:
Different real-time PCR systems employ different strategies for normalization of fluorescent signals and correction of well-to-well optical variations. It is critical to match the appropriate qPCR reagent to your specific instrument. KiCqStart SYBR Green qPCR ReadyMix does not contain an internal reference dye. Compatible instruments include:

Bio-Rad® CFX384™
Bio-Rad CFX96™
Bio-Rad MiniOpticon™
Bio-Rad/MJ Chromo4™
Bio-Rad/MJ Opticon 2
Bio-Rad/MJ Opticon™
Cepheid SmartCycler®
Eppendorf Mastercycler® ep realplex
Eppendorf Mastercycler ep realplex2 s
Illumina Eco qPCR
Qiagen/Corbett Rotor-Gene® 3000
Qiagen/Corbett Rotor-Gene 6000
Qiagen/Corbett Rotor-Gene Q
Roche LightCycler® 480

KiCqStart® SYBR® Green qPCR ReadyMix™ has been used to perform quantitative real-time PCR (qPCR).
PCR applications:

Gene expression
DNA quantitation
CHiP

Components
2X reaction buffer containing optimized concentrations of MgCl2, dNTPs (dATP, dCTP, dGTP, dTTP), KiCqStart Taq DNA Polymerase, SYBR Green dye, and stabilizers
packaging:
250 reactions* = 2 X 1.25 mL tubes
1250 reactions* = 10 X 1.25 mL tubes
5000 reactions* = 1 X 50 mL tube
*number of reactions based on a 20uL volume

Assay results in as little as 33 minutes
Highly efficient and sensitive real-time PCR results
Little/no optimization required

Storage Conditions:
KiCqStart SYBR Green qPCR ReadyMix is stable for 1 year when stored in a constant temperature freezer at -20°C, protected from light. For convenience, it may be stored unfrozen at +2 to +8°C for up to 6 months. After thawing, mix thoroughly before using. Repeated freezing and thawing of the product is not recommended. However, the product demonstrated no loss of performance after 20 freeze-thaw cycles or 2 months at +20°C.

form	liquid
feature	hotstart
storage condition	protect from light
application(s)	qPCR: suitable
color	colorless
compatibility	for use with Bio-Rad CFX384, for use with Bio-Rad CFX96, for use with Bio-Rad MJ Chromo4, for use with Bio-Rad MJ Opticon 2, for use with Bio-Rad MJ Opticon Cepheid SmartCycler, for use with Bio-Rad MiniOpticon, for use with Bio-Rad MyiQ, for use with Eppendorf^® Mastercycler ep realplex2 s, for use with Eppendorf^® Mastercycler ep realplex, for use with Illumina Eco qPCR, for use with Qiagen Corbett Rotor-Gene 3000, for use with Qiagen Corbett Rotor-Gene 6000, for use with Qiagen Corbett Rotor-Gene Q, for use with Roche LightCycler 480
detection method	SYBR^® Green
shipped in	dry ice
storage temp.	20°C

LuminoCt® qPCR ReadyMix combines the performance enhancements of our JumpStart™ Taq antibody for hot start PCR with the convenience of an easy-to-use reaction mixture. This is the ideal solution for performing high-throughput, quantitative PCR methods that rely on a fluorescent probe.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 3
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

LuminoCt® qPCR ReadyMix™

LuminoCt® qPCR ReadyMix™ has been used in 2-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay to quantify the reverse transcription product or cDNA for gene expression analysis.
LuminoCt qPCR ReadyMix is designed to deliver unsurpassed assay speeds without sacrificing accuracy, precision, or sensitivity. Extensive design and validation of the ReadyMix chemistry has virtually eliminated the need for optimization when LuminoCt is used in conjunction with properly designed primers and probes. Inclusion of JumpStart™ Taq antibody in the ReadyMix eliminates polymerase activity at ambient temperatures without causing the performance issues associated with chemically modified hot-start Taq. This allows for very rapid activation of the Taq and delivers unparalleled assay sensitivity, while allowing for benchtop reaction setup.

Kit is designed to perform probe-based qPCR assays on commonly available real-time instrument platforms.
ReadyMix requires the addition of reference dye (provided in kit) when being used on real-time instruments that require ROX passive reference dye for normalization of qPCR assays.
Kit is not compatible with qPCR instruments that utilize glass capillary tubes.

Packaging
LuminoCt qPCR ReadyMix, Catalog Number L5794, contains optimized concentrations of Tris-HCl, pH 8.3, KCl, dNTPs (dATP, dCTP, dGTP, TTP), stabilizers, MgCl2 and JumpStart Taq DNA Polymerase. Provided as 100, 500 and 2000 reactions (25 µL mix in a 50 µL reaction volume).
100x ROX internal reference dye, Catalog Number R4526. Optional, for use with machines compatible with an internal reference dye, e.g., ABI and Stratagene.
Default reaction volume is 50 µL
100RXN is packaged as 1 X 2.5 mL
500RXN is packaged as 1 X 12.5 mL
2000RXN is packaged as 1 X 50 mL

Ideal for rapid, high-throughput 2-step qPCR protocols
The master mix allows consistency and reproducibility from one reaction to the next
Reduced preparation time and the risk of contamination from multiple pipetting steps
Compatible with commonly available real-time instrument platforms for probe-based qPCR assays
Require small amplicons (<200 bp) for optimal results
Compatible with commercial primer sets, including TaqMan® assays
JumpStart™ Taq DNA polymerase allows room temperature set-up and the hot-start mechanism prevents primer-dimer and non-specific product formation

Assay results in as little as 25 minutes
Unsurpassed accuracy, precision, and sensitivity
Virtually eliminates the need to optimize assay parameters

To order primers and probes from Sigma, visit www.sigma.com/oligos,

Commercially available 5 nuclease assays (e.g., TaqMan® Assays) are compatible with LuminoCt ReadyMix.
At a minimum, use software to design primers and probes for assays and ensure that qPCR amplicons are <200 bp.
Sigma recommends designing primers and probes with Beacon Designer software,

Eppendorf is a registered trademark of Eppendorf AG
JumpStart is a trademark of Sigma-Aldrich Co. LLC
LuminoCt is a registered trademark of Sigma-Aldrich Co. LLC
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
TaqMan is a registered trademark of Roche Molecular Systems, Inc.

Quality Level	200,
form	liquid
feature	hotstart
application(s)	qPCR: suitable
color	colorless
Featured Industry	Agriculture
compatibility	for use with ABI 5700, for use with ABI 7000, for use with ABI 7300, for use with ABI 7500 Fast, for use with ABI 7500, for use with ABI 7700, for use with ABI 7900 Fast, for use with ABI 7900 HT, for use with ABI 7900, for use with ABI StepOne, for use with ABI StepOnePlus, for use with ABI ViiA 7, for use with Bio-Rad CFX384, for use with Bio-Rad CFX96, for use with Bio-Rad MJ Chromo4, for use with Bio-Rad MJ Opticon 2, for use with Bio-Rad MJ Opticon Cepheid SmartCycler, for use with Bio-Rad MJ Opticon, for use with Bio-Rad MiniOpticon, for use with Eppendorf^® Mastercycler ep realplex2 s, for use with Eppendorf^® Mastercycler ep realplex, for use with Illumina Eco qPCR, for use with Qiagen Corbett Rotor-Gene 3000, for use with Qiagen Corbett Rotor-Gene 6000, for use with Qiagen Corbett Rotor-Gene Q, for use with Roche LightCycler 480, for use with Strategene Mx3000P, for use with Strategene Mx3005P, for use with Strategene Mx4000
detection method	probe-based
shipped in	wet ice
storage temp.	20°C

LuminoCt SYBR Green qPCR ReadyMix is designed to deliver unsurpassed assay speeds without sacrificing accuracy, precision, or sensitivity. Extensive design and validation of the ReadyMix chemistry has virtually eliminated the need for optimization when LuminoCt is used in conjunction with properly designed primers. Inclusion of JumpStart™ Taq antibody in the ReadyMix eliminates polymerase activity at ambient temperatures without causing the performance issues associated with chemically modified hot-start Taq. This allows for very rapid activation of the Taq and delivers unparalleled assay sensitivity, while allowing for benchtop reaction setup.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1

Узнать цену

Подробнее

LuminoCt® SYBR® Green qPCR ReadyMix™

Kit is designed to perform SYBR Green-based qPCR assays on commonly available real-time instrument platforms
ReadyMix requires the addition of reference dye (provided in kit) when being used on real-time instruments that require ROX passive reference dye for normalization of qPCR assays
Kit is not compatible with qPCR instruments that utilize glass capillary tubes

LuminoCt® SYBR® Green qPCR ReadyMix™ has been used for fast qPCR and quantitative RT-PCR amplifications.
Features and Benefits

Assay results in as little as 25 minutes
Unsurpassed accuracy, precision, and sensitivity
Virtually eliminates the need to optimize assay parameters

Packaging
Default reaction volume is 50 µL
100RXN is packaged as 1 X 2.5 mL
500RXN is packaged as 1 X 12.5 mL
2000RXN is packaged as 1 X 50 mL

At a minimum, use software to design primers for assays and ensure that qPCR amplicons are <200 bp
Sigma recommends designing primers and probes with Beacon Designer software,
To order primers and probes from Sigma, visit: www.sigma.com/oligos,

Eppendorf is a registered trademark of Eppendorf AG
JumpStart is a trademark of Sigma-Aldrich Co. LLC
LuminoCt is a registered trademark of Sigma-Aldrich Co. LLC
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies
SabreLite is a registered trademark of Pelican Products, Inc.

Quality Level	200,
form	liquid
feature	hotstart
application(s)	qPCR: suitable
color	colorless
Featured Industry	Agriculture
compatibility	for use with ABI 5700, for use with ABI 7000, for use with ABI 7300, for use with ABI 7500 Fast, for use with ABI 7500, for use with ABI 7700, for use with ABI 7900 Fast, for use with ABI 7900 HT, for use with ABI 7900, for use with ABI StepOne, for use with ABI StepOnePlus, for use with ABI ViiA 7, for use with Bio-Rad CFX384, for use with Bio-Rad CFX96, for use with Bio-Rad MJ Chromo4, for use with Bio-Rad MJ Opticon 2, for use with Bio-Rad MJ Opticon Cepheid SmartCycler, for use with Bio-Rad MJ Opticon, for use with Bio-Rad MiniOpticon, for use with Eppendorf^® Mastercycler ep realplex2 s, for use with Eppendorf^® Mastercycler ep realplex, for use with Illumina Eco qPCR, for use with Qiagen Corbett Rotor-Gene 3000, for use with Qiagen Corbett Rotor-Gene 6000, for use with Qiagen Corbett Rotor-Gene Q, for use with Roche LightCycler 480, for use with Strategene Mx3000P, for use with Strategene Mx3005P, for use with Strategene Mx4000
detection method	SYBR^® Green
shipped in	wet ice
storage temp.	20°C

This lysis solution is a component of the REDExtract-N-Amp™ Blood PCR Kits for the rapid extraction and amplification of human genomic DNA from whole blood, whole blood dried on a blood card, and cultured mammalian cells.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1

Узнать цену

Подробнее

Lysis solution for blood

Lysis solution for blood has been used for lysis of approximately 2X104 cells in 10 µl of blood for polymerase chain reaction (PCR) amplification and sequencing of library alleles from screened cell lines.

REDExtract-N-Amp is a trademark of Sigma-Aldrich Co. LLC

Quality Level	200,
grade	for molecular biology
form	liquid
storage temp.	20°C

M-MLV (Moloney murine leukemia virus) reverse transcriptase enzyme is isolated from E. coli expressing a portion of the pol gene of M-MLV on a plasmid. MoMLV RT is made up of 671 amino acid residues. It is a DNA polymerase that uses single-stranded RNA, DNA, or an RNA-DNA hybrid (using a primer) to synthesize a complementary DNA strand.

pictograms	GHS05
signalword	Danger
hcodes	H290 - H314
pcodes	P234 - P280 - P303 + P361 + P353 - P304 + P340 + P310 - P305 + P351 + P338 - P363
RIDADR	UN 3266 8 / PGIII
WGK Germany	WGK 3
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

M-MLV Reverse Transcriptase

CAS Number:	9068-38-6
MDL number:	MFCD00283754
NACRES:	NA.55

M-MLV Reverse Transcriptase has been used:

for the preparation of cDNA libraries or for first strand cDNA synthesis
for use in a 2-step RT-PCR assay
for the synthesis of cDNA that is further used in cloning

M-MLV Reverse Transcriptase has been used:

to synthesize cDNA
in quantitative realtime-polymerase chain reaction (RT-qPCR)
in reverse transcription

M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase is a DNA polymerase that uses single-stranded RNA, DNA, or an RNA-DNA hybrid (using a primer) to synthesize a complementary DNA strand. M-MLV is used for the preparation of cDNA libraries or for first strand cDNA synthesis for use in RT-PCR reactions.
Features and Benefits

Thermostable reverse transcriptase active at 37 °C.
Can be used to generate first strand cDNA of up to 7 kb.

Packaging
Supplied with 10x M-MLV reverse transcriptase buffer containing DTT.
Unit Definition
One unit incorporates 1 nmol of TTP into acid precipitable material in 10 min. at 37 °C using poly(A):oligo dT as a template:primer.
Preparation Note
The enzyme is purified from Escherichia coli expressing the pol gene of M-MLV on a plasmid.

Purchase of this product is accompanied by a limited license for use in the Polymerase Chain Reaction (PCR) process for research purposes only and in conjunction with a thermal cycler whose use in the automated performance of the PCR process is covered by an up-front license fee, either by payment to Applied Biosystems or as purchased, i.e., and authorized thermal cycler.

Quality Level	200,
recombinant	expressed in E. coli
feature	hotstart: no
concentration	200 units/µL
application(s)	RT-PCR: suitable
color	colorless
shipped in	wet ice
storage temp.	20°C

Suitability
Suitable for optimization of polymerase chain reactions.

Personal Protective Equipment	Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US),
RIDADR	NONH for all modes of transport
WGK Germany	WGK 3
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

Magnesium chloride solution

Empirical Formula (Hill Notation):	Cl₂Mg
Linear Formula:	MgCl₂
CAS Number:	7786-30-3
Molecular Weight:	95.21
MDL number:	MFCD00011106
PubChem Substance ID:	57654422
NACRES:	NA.52

For routine PCR amplifications.
Optimization of MgCl2 concentration in PCR reactions for improved yield.

grade	PCR Reagent
Quality Level	300,
form	liquid
packaging	vial of 1.5 mL
concentration	25 mM±1 mM
application(s)	PCR: suitable
color	colorless
Featured Industry	Agriculture Diagnostic Assay Manufacturing
foreign activity	DNase, RNase, none detected
storage temp.	2-8°C
SMILES string	Cl[Mg]Cl
InChI	1S/2ClH.Mg/h2*1H;/q;;+2/p-2
InChI key	TWRXJAOTZQYOKJ-UHFFFAOYSA-L

Fully methylated Jurkat DNA. 5-methyl-cytidine (5mC) content determined by mass spectrometry. See lot specific certificate of analysis or vial label for 5mC content of each lot.

Personal Protective Equipment	Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US),
RIDADR	NONH for all modes of transport
WGK Germany	nwg
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

Methylated Control DNA

Methylated Control DNA has been used as a negative control in bisulfite sequencing of embryonic genomic DNA.

form	liquid
Quality Level	200,
concentration	50 ng/μL
color	colorless
storage temp.	−20°C

Packaging
5 vials in poly bottle

Personal Protective Equipment	Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US),
RIDADR	NONH for all modes of transport
WGK Germany	WGK 3
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

11699113001

MgCl2 Stock Solution 11699113001

General description
The MgCl2 Stock Solution is used for the individual adjustment of the Mg2+-concentration in the PCR reaction and can be used in combination with the PCR buffer without MgCl2. In most applications a concentration of 1.5mM MgCl2 will yield satisfactory results with a dNTP concentration of 200µM each. In many cases, however, it is required to titrate the optimal Mg2+ concentration to increase the specificity and the yield of the PCR reaction.
Application
The combination of PCR Buffer without MgCl2 and the MgCl2 Stock Solution buffer are optimized for the amplification of specific DNA fragments in conventional PCRs (i.e., with Taq DNA Polymerase). However, the MgCl2 Stock Solution may be used with other, more appropriate PCR buffers to optimize any type of PCR (e.g., hot start PCR, high fidelity PCR, long template PCR).
Biochem/physiol Actions
Magnesium (Mg2+) chelates nucleotide triphosphates (dNTPs) and its usage is one among the optimization strategies for polymerase chain reaction (PCR). It promotes orthophosphate synthesis from oligophosphates by stabilizing the phosphate groups of nucleotides.
Physical form
The MgCl2 Stock Solution contains 25mM MgCl2 in sterile water.
Other Notes
For life science research only. Not for use in diagnostic procedures.
Параметры

form solution

Quality Level 100,

packaging pkg of 3 x 1 mL

Торговая марка Roche

concentration 25 mM

shipped in dry ice

storage temp. 20°C

Safety Information

RIDADR NONH for all modes of transport

WGK Germany nwg

Flash Point F does not flash

Flash Point C does not flash

Узнать цену Получить предложение
Подробнее

Mineral oil

CAS Number:	8042-47-5
EC Number:	232-455-8
MDL number:	MFCD00131611
NACRES:	NA.52

Кат. номер

M8662-5VL

M8662-1VL

For routine PCR amplifications.
Minimizes evaporation of reactions run in PCR instruments without heated lids.

Provided in a convenient 5 x 1.5 mL (1 vial) pack size

grade	PCR Reagent
Quality Level	100,
form	liquid
packaging	vial of 1.5 mL (Total volume 7.5 mL (5 vials))
application(s)	PCR: suitable
color	colorless
refractive index	n20/D 1.467 (lit.)
density	0.84 g/mL at 25 °C (lit.)
foreign activity	DNase, RNase, protease, none detected
storage temp.	room temp
InChI key	AEOVEGJBKQQFOP-DDVLFWKVSA-L

The MystiCq microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.
Features and Benefits
Features and Benefits

Personal Protective Equipment	Eyeshields,, Gloves,
RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	No data available
Flash Point C	No data available

Узнать цену

Подробнее

MystiCq® microRNA qPCR Assay Primer MIRAP00047-250RXN

miRNA ID:	hsa-miR-21-5p Sanger Database
NACRES:	NA.55

General description

Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
No self-complementarity or primer dimer artifacts with the Universal PCR Primer
Optimized primer Tm designed to match the Universal PCR Primer
Universal cycling conditions ensures robust amplification for all assays in profiling experiments
Optimized PCR product Tm (75-78° C)

Formerly hsa-miR-21. Compatible with mmu-miR-21 and rno-miR-21.

MystiCq is a registered trademark of Qiagen Beverly Inc.

form	liquid
concentration	10 mg/mL
mature sequence	UAGCUUAUCAGACUGAUGUUGA
mp	~77 °C
Sanger mature/minor accession no.	MIMAT0000076,
shipped in	wet ice
storage temp.	20°C
Gene Information	human ... MIR21(406991)

The MystiCq microRNA qPCR Control Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific small RNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

MystiCq® microRNA qPCR Control Primer MIRCP00001-250RXN

miRNA ID:	RNU6-1 Sanger Database
NACRES:	NA.55

General description

U6 small nuclear 1 (RNU6-1) gene primer has been used as a positive control for qPCR.
Features and Benefits
Features and Benefits

Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
No self-complementarity or primer dimer artifacts with the Universal PCR Primer
Optimized primer Tm designed to match the Universal PCR Primer
Universal cycling conditions ensures robust amplification for all assays in profiling experiments
Optimized PCR product Tm (75-78° C)

Detects RNU6-1 and RNU6-2. Compatible with mouse and rat.

GenBank is a registered trademark of United States Department of Health and Human Services
MystiCq is a registered trademark of Qiagen Beverly Inc.

form	liquid
mature sequence	GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU
mp	~76.5 °C
GenBank^® mature/minor accession no.	NR_004394.1,
shipped in	wet ice
storage temp.	20°C
Gene Information	human ... RNU6-1(26827)

This neutralization solution is a component of the REDExtract-N-Amp™ Blood PCR Kits for the rapid extraction and amplification of human genomic DNA from whole blood, whole blood dried on a blood card, and cultured mammalian cells.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

Neutralization Solution for Blood

REDExtract-N-Amp is a trademark of Sigma-Aldrich Co. LLC

Quality Level	200,
grade	for molecular biology
form	liquid
storage temp.	room temp

Packaging
0.1 mL in poly bottle

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

Oligo(dT)23, Anchored

The Anchored Oligo(dT)23 Primers have 23 thymidine residues and one G, C, or A residue (the anchor) at the 3 end. This anchor ensures the oligo(dT)23 primer binds at the beginning of the message such that there are no long regions of unusable sequence. Anchored oligo(dT)23 primers may provide an advantage over standard oligo(dT) primers when generating cDNA from poly(A)+ RNA.

usage	0.1 mL sufficient for 100 RT-PCR reactions (as described in the Technical Bulletin for Product Codes HSRT100 and HSRT20)
Quality Level	200,
concentration	70 µM in H₂O
color	colorless
shipped in	wet ice
storage temp.	20°C

The PCR Master contains all the reagents required to perform a standard PCR. All that must be added is the template DNA, the primers, and the required amount of water. The PCR Master contains a fixed MgCl2 concentration of 1.5 mM. However, higher concentrations may be achieved by adding additional MgCl2. PCR products generated by PCR Master are 3-A single-overhang products. Therefore T/A cloning can be applied.
The PCR Master is stable at +2 to +8 °C, allowing immediate PCR without the time-consuming thawing of reagents.
Routine assays have medium size amplicons and 50% GC content. Taq DNA Polymerase has no proofreading or hot start features. It is optimally active at +75°C and pH 9. The 5 3 DNA polymerase lacks 3 5 exonuclease activity. The thermostable enzyme is a single polypeptide chain with a molecular weight of approximately 95 kD.
Lack of restriction endonuclease:
The enzyme originally isolated from T. aquaticus BM lacks Taq I restriction endonuclease activity.

Personal Protective Equipment	Eyeshields,, Gloves,
RIDADR	NONH for all modes of transport
WGK Germany	WGK 3
Flash Point F	Not applicable
Flash Point C	Not applicable

Узнать цену

Подробнее

PCR Master 11636103001

General description

The PCR Master can be used instead of the single reagent Taq DNA Polmerase, or instead of the PCR Core Kit for nearly all simple, routine polymerase chain reaction applications. The only limitation is that the sample volume must not exceed half the total reaction volume. The PCR master mix is used for:

Routine PCR
RT-PCR
Other primer-extension reactions, such as sequencing and labeling

High lot-to-lot consistency.

Reliable reproducible results:

Convenience:

Adding template and primer requires only two pipetting steps.

Prevent PCR carryover:

dUTP incorporation combination with Uracil-DNA Glycosylase prevents PCR cross-contamination.

Ready for immediate use:

Master mix can be stored at +2 to +8°C.
Packaging
1 kit containing 2 components.
Quality
Each lot is PCR tested using λDNA. Each lot is also tested for the absence of exo- and endonucleases, and nicking activities according to the current Quality Control procedures.

For life science research only. Not for use in diagnostic procedures.

Use of this product is covered by US patent claims and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim, no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patent claims require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.</ br>NOTICE TO PURCHASER: LIMITED LICENSE<br />Use of this product is covered by US Patent No. 6,127,155 and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser′s own internal research. No right under any other patent claim and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser′s activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Human and veterinary diagnostic uses under Roche patent claims require a separate license from Roche. All uses other than internal research and human and veterinary diagnostic uses under Roche patent claims require a separate license from Thermo Fisher Scientific. Further information on purchasing licenses from Roche may be obtained by contacting the Licensing Department of Roche Molecular Systems, Inc., 4300 Hacienda Drive, Pleasanton, California 94588, USA or Roche Diagnostics GmbH, Sandhofer Strasse 116, 68305 Mannheim, Germany. Further information on purchasing licenses from Thermo Fisher Scientific may be obtained by contacting the Licensing Department of Thermo Fisher Scientific, 5791 Van Allen Way, Carlsbad, California 92008, USA.

usage	sufficient for 200 reactions, (50 μl final reaction volume each containing 2.5 U Taq DNA-Polymerase)
Quality Level	100,
feature	dNTPs included, hotstart: no
Торговая марка	Roche
application(s)	PCR: suitable
input	purified DNA
shipped in	dry ice
storage temp.	−20°C

PCR Nucleotide Mix is a clear, colorless solution of the sodium salts of dATP, dCTP, dGTP, and dTTP, each at a concentration of 10 mM in Water, PCR Grade. This nucleotide mixture can be added directly to polymerase chain reactions.

RIDADR	NONH for all modes of transport
WGK Germany	WGK 1
Flash Point F	does not flash
Flash Point C	does not flash

Узнать цену

Подробнее

PCR Nucleotide Mix

Features and Benefits
The PCR Nucleotide Mix can be added directly to amplification reactions. PCR Grade nucleotides from Roche are specially manufactured and purified to the highest possible chemical purity.

Improve yield and performance

The PCR Nucleotide Mix is optimized for use in all types of amplification reactions and primer-extension reactions: PCR
RT-PCR
cDNA synthesis
Primer extension

Choose a convenient ready-to-use mix of all 4 nucleotides.
Achieve the highest PCR and RT-PCR sensitivity.
Insist on highest purity (>99%) nucleotides.

Packaging
1 set containing 4 ready-to-use mixes
Quality
Function Testing in PCR
Function Testing in RT-PCR
Absence of Contaminating Deoxyribonucleases/Nicking Activities according to the current Quality Control procedures.
Absence of Contaminating Ribonucleases according to the current Quality Control procedures.
Preparation Note
Activator: Mg2+
Working solution: If required, the solutions can be diluted with distilled autoclaved water.
Storage conditions (working solution): It will withstand 50 freeze/thaw cycles.

For life science research only. Not for use in diagnostic procedures.

form	solution
Quality Level	100,
usage	sufficient for 2,500 reactions (04638956001), sufficient for 5,000 reactions (11814362001), sufficient for 500 reactions (11581295001)
packaging	pkg of 10 x 200 μL (11814362001 [10mM, each]), pkg of 200 μL (11581295001 [10 mM, each]), pkg of 5 x 200 μL (04638956001 [10 mM, each])
Торговая марка	Roche
shipped in	dry ice
storage temp.	−20°C

NONH for all modes of transport

RIDADR

Узнать цену

Подробнее

Protector RNase Inhibitor

Protector RNase Inhibitor inactivates a wide spectrum of RNases, including

RNase A
RNase B
RNase T2

Thus, Protector RNase Inhibitor can help prevent RNase degradation in any application where RNases could cause problems. For instance, it can:

protect mRNA during cDNA synthesis reactions, RT-PCR (in conventional thermal cyclers and qPCR systems), or in vitro transcription/translation reactions
protect viral RNA during in vitro virus replication
inhibit RNases during RNA isolation and purification
be used in RNase protection assays
help prepare RNase-free antibodies

Note: Protector RNase Inhibitor does not interfere with enzymes commonly used to prepare or analyze RNA.
Contents
Protector RNase Inhibitor (40 U/µl) in storage buffer: 20 mM HEPES-KOH, 50 mM KCl, 8 mM dithiothreitol, 50% glycerol (v/v), pH approximately 7.6 (+4°C).

Specificity

Protector RNase Inhibitor definetely does not inhibit RNase T1 and RNase 1.
Protector RNase Inhibitor (20 U/ 20 µl reaction) inhibits RNase A up to 1 ng, RNase B up to 160 pg and RNase T2 up to 0.03 U/µl reaction volume.
RNase H is not inhibited by Protector RNase Inhibitor.
Heat inactivation: > 65 °C

Protector RNase Inhibitor may be used to:

Protect mRNA in cDNA synthesis reactions, RT-PCR (in conventional thermal cyclers and qPCR systems), e.g., with the LightCycler® Instruments, in vitro transcription/translation system, RNase Protection Assay, in vitro RNA synthesis
Protect viral RNA during in vitro virus replication
Inhibit RNases during RNA isolation and purification
Help prepare RNase-free antibodies
Synthesize RNA probes for in situ hybridization

It is useful in any application where RNases could be a potential problem.

Each lot of Protector RNase Inhibitor is function tested with the Titan One Tube RT-PCR Kit and the LightCycler DPD Kit. Protector RNase Inhibitor is also tested for contaminating activities as described below.
Test buffer: 50 mM Tris-HCl, 10 mM MgCl2, 0.1 mM EDTA, 7 mM -Mercaptoethanol; pH 7.5 (+37°C).
Absence of endonucleases: 1 µg EcoR I/Hind III*-fragments of DNA is incubated with Protector RNase Inhibitor in 50 µl test buffer at +37°C for 1 hour. The amount of inhibitor that causes no alteration in the banding pattern is stated under "Endo".
Absence of nicking activity: 1 µg supercoiled pBR322 DNA is incubated with Protector RNase Inhibitor in 50 µl test buffer at +37°C for 1 hour. The amount of inhibitor that causes no relaxation of supercoiled DNA is stated under "Nick. Act.".
Absence of ribonuclease (1): 5 µg of MS2 RNA is incubated with Protector RNase Inhibitor for 1 hour at +37°C in a final volume of 50 µl. The amount of inhibitor that causes no degradation of MS2 RNA is stated under "RNase 1".
Absence of ribonuclease (2): 5 µg of MS2 RNA is incubated with Protector RNase Inhibitor for 1 hour at +37°C, then 10 minutes at +65°C in a final volume of 50 µl. The amount of inhibitor that causes no degradation of MS2 RNA is stated under "RNase 2".

Rely on a thermostable RNase inhibitor: Protector RNase Inhibitor remains stable even when using thermostable reverse transcriptases such as Transcriptor Reverse Transcriptase.
Benefit from a wide range of reaction conditions: Protector RNase Inhibitor is active at pH 5.0 to 9.0 and at temperatures between +25°C to +55°C (partial activity is still measureable at +60°C).
Eliminate interference in different RNA analysis applications: Maintain performance even when adding at 16-fold higher than the standard concentration.
Insist on a highly-purified preparation: Each batch is function tested using techniques such as quantitative RT-PCR to ensure the absence of endonucleases, ribonucleases, or nicking activity, according to the current quality control procedures.

Quality

Unit Definition

One unit of Protector RNase Inhibitor is defined as the amount of protein required to inhibit 50% of the activity of 5 ng RNase A.
Unit Assay: Activity is measured according to Blackburn as ability to inhibit hydrolysis of cyclic cytidine-2 : 3-monophosphoric acid. Under assay conditions, 200 U of Protector RNase Inhibitor inhibits 50% of the activity of 1 µg RNase A.
Volume Activity: 40 U/µl

Preparation Note

Working concentration:

5 to 10 U in One-step RT-PCR
25 to 50 U in Two step RT-PCR
20 U for in vitro transcription

You may use higher concentrations of Protector RNase Inhibitor in RT-PCR if you suspect that RNase contamination causes certain samples to be difficult to amplify. The inhibitor does not interfere with the reaction. (In a test system, even a 16-fold higher concentration
of inhibitor did not interfere with RT-PCR.)

Product Specifications:
Source: Rat lung; Product is produced recombinant in E. coli
Isoelectric Point: pH 4.5
Temperature where Protector RNase Inhibitor is active: 25°C to +55°C; partial activity is still measurable at +60°C
Inactivation: Under severe denaturizing conditions (temperatures above +65°C), the inhibitor is inactivated
Bioburden: <50 cfu/ml
DNA Content: <100 pg/mg
For life science research only. Not for use in diagnostic procedures.

NOTICE TO PURCHASER: DISCLAIMER OF LICENSE
This product is optimized for use in the polymerase chain reaction (PCR) covered by patents owned by F. Hoffmann-La Roche Ltd ("Roche"). No license under these patents to use the PCR Process is conveyed expressly or by implication to the purchaser by the purchase of this product. A license to use the PCR Process for certain research and development activities accompanies the purchase of certain Roche, Applied Biosystems or other licensed suppliers reagents when used in conjunction with an authorized thermal cycler, or is available from Applied Biosystems. Diagnostic purposes require a license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing at Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
LightCycler is a registered trademark of Roche

Quality Level	100
assay	>95% (SDS-PAGE)
mol wt	~50 kDa
packaging	pkg of 10,000 U (03335402001 5 x 2,000 U), pkg of 2,000 U (03335399001)
mfr. no.	Roche
parameter	25-55 °C optimum reaction temp.
pH range	5.0 - 9.0
shipped in	dry ice
storage temp.	−20°C

Enzyme Commission (EC) Number:

Узнать цену

Подробнее

Pwo DNA Polymerase

2.7.7.7 ( BRENDA | IUBMB )

Pwo DNA Polymerase is a highly processive thermostable 5′-3′ DNA polymerase and possesses a 3′–5′ exonuclease activity, also known as proofreading activity. The enzyme has no detectable 5′–3′ exonuclease activity. Pwo DNA Polymerase exhibits increased thermal stability with a half-life of more than two hours at +100 °C, compared to Taq DNA Polymerase′s half-life of less than 5 minutes at this temperature. Pwo DNA Polymerase-generated PCR products are blunt-ended and can therefore be used directly for blunt-end ligation without any pretreatment of the ends.

Due to its proofreading activity, the thermostable Pwo DNA Polymerase has an extremely low error rate, 18-fold lower compared to Taq DNA Polymerase. It is therefore ideal for applications that require the highest possible fidelity in DNA synthesis. It can be applied for High fidelity PCR
Cloning of PCR products
Characterization of rare mutations
PCR

Packaging
1 kit containing 4 components
Quality
Each lot of Pwo DNA polymerase is assayed for:

Excellent accuracy (18-fold more accurate than Taq DNA polymerase)
High thermal stability
Nearly as processive as Taq DNA polymerase
Accepts modified nucleotides

Activity: The enzyme is tested on activated DNA.
Function: The enzyme is tested in two PCRs, using DNA and human genomic DNA as templates.
Proofreading ability: Proofreading activity is assayed according to the laq Iq fidelity assay [Frey, B. & Suppmann, B. (1995) Biochemica 2. 8-9].
Absence of nucleases: The enzyme is tested on various substrates to ensure the absence of detectable endonucleases, exonucleases, and nicking activity according to the current Quality Control procedures.

Unit Definition
One unit Pwo DNA polymerase is defined as the amount of enzyme that catalyzes the incorporation of 10 nmol total deoxynucleoside triphosphates into acid precipitable DNA within 30 minutes at +70 °C under the conditions described below.
Unit Assay: Incubation buffer for assay on activated DNA

20 mM Tris-HCl, pH 8.8 (20 °C), 50 mM KCl, 2.5 mM MgCl2, 10 mM 2-mercaptoethanol, 0.2 mM of each dATP, dCTP, dGTP, dTTP.
Incubation procedure
12.5 mg activated calf thymus DNA and 0.1 mCi [-32P]dCTP are incubated with 0.01 to 0.1 U Pwo DNA Polymerase in 50 µl incubation buffer with a paraffin oil overlay at +70 °C for 30 minutes. The amount of incorporated dNTPs is determined by trichloroacetic acid precipitation followed by scintillation counting.
Volume Activity: 5 U/µl
Preparation Note
Pwo DNA polymerase was originally isolated from Pyrococcus woesei, a hyperthermophilic archaebacterium.
Modified nucleotides are substrates
Pwo DNA Polymerase accepts modified nucleotides like digoxigenin-dUTP, biotin-dUTP, or fluorescein-dUTP. Thus, it can add these nucleotides to DNA during PCR. These nonradioactively labeled products can be used as a hybridization probe in many applications.
Magnesium concentration
If you use the magnesium-containing reaction buffer supplied with the enzyme, the final MgCl2 concentration in the PCR will be 2.0mM. For other magnesium concentrations (e.g., for optimizing the reaction to accommodate a particular template), use the magnesium-free reaction buffer and add appropriate amounts of the magnesium stock.

For life science research only. Not for use in diagnostic procedures.

usage	sufficient for ≤200 reactions (11644955001), sufficient for ≤40 reactions (11644947001)
Quality Level	100,
feature	High Fidelity PCR, dNTPs included: no, hotstart: no
packaging	pkg of 100 U (11644947001), pkg of 500 U (11644955001 [2 x 250 U])
Торговая марка	Roche
application(s)	PCR: suitable
shipped in	dry ice
storage temp.	−20°C

NONH for all modes of transport

RIDADR

Узнать цену

Подробнее

Pwo SuperYield DNA Polymerase

Enzyme Commission (EC) Number:

2.7.7.7 ( BRENDA | IUBMB )

Pwo SuperYield DNA Polymerase combines the recombinant enzyme Pwo DNA Polymerase with an optimized buffer system. This buffer system enhances the enzymatic properties of the polymerase, resulting in higher yields of the amplification reaction without changing the fidelity of DNA synthesis. This enzyme delivers excellent results due to its enzyme design and optimized buffer system. Amplify fragments up to 3 kb - even longer amplicons are possible from simple templates.
Pwo SuperYield DNA Polymerase exhibits increased thermal stability with a half life of greater than 2 hours at +100 °C compared to Taq DNA Polymerase with a half life of less than 5 min at this temperature.
Pwo SuperYield DNA Polymerase, originally isolated from Pyrococcus woesei, is a processive 5 3 DNA polymerase with 3 5 exonuclease proofreading activity; 5 3 exonuclease activity is not detectable.
The enzyme accepts modified nucleotides for efficient labeling of nucleic acids by PCR.
PCR products are blunt-ended directly useable for blunt-end ligation.
Using the magnesium-containing reaction buffer supplied, the final MgCl2 concentration is 1.5mM.
Specificity
Star activity: In cases where star activity is observed and/or the activity of the enzyme in the PCR mix is low, first purify the amplification product prior to the restriction enzyme digest using High Pure PCR Product Purification Kit.

Features and Benefits
Pwo SuperYield DNA Polymerase yields more high fidelity PCR product. The optimized buffer delivers superior results. Amplify fragments up to 3kb. A GC-RICH Solution is included for difficult templates.

Pwo Super Yield DNA Polymerase combines the recombinant enzyme Pwo DNA Polymerase with a newly optimized buffer system. Pwo SuperYield DNA Polymerase is used for the amplification of DNA with the intent to sequence the amplification product or to clone the product (e.g., for the expression of the gene product). The high fidelity of this enzyme makes it particularly suitable for: High fidelity PCR
Site-directed mutagenesis
Cloning
Gene expression
Study of allelic polymorphism in individual RNA transcripts
Characterization of rare mutations in tissue
Characterization of the allelic stage of single cells or single DNA molecules

Higher yield and 18-fold higher fidelity

compared to Taq DNA Polymerase.

High performance with difficult templates.

The GC-RICH Solution is for GC-rich PCR.

Reduce working steps in cloning.

Perform digests directly in Pwo SuperYield PCR mix.
Packaging
1 kit containing 3 components
Quality
Each lot is assayed using activated DNA. PCR testing used λ and human genomic DNA.
Unit Definition
One unit Pwo SuperYield DNA Polymerase is defined as the amount of enzyme that catalyzes the incorporation of 10 nmol total deoxynucleoside triphosphates into acid precipitable DNA within 30 minutes at +70 °C.
Unit Assay: Incubation buffer for assay on activated DNA
20 mM Tris-HCl, pH 8.8 (20 °C), 50 mM KCl, 2.5 mM MgCl2, 10 mM 2-mercaptoethanol, 0.2 mM of each dATP, dCTP, dGTP, dTTP.
Incubation procedure
12.5 mg activated calf thymus DNA and 0.1 mCi [-32P]dCTP are incubated with 0.01 to 0.1 U Pwo SuperYield DNA Polymerase in 50 µl incubation buffer with a paraffin-oil overlay at +70 °C for 30 minutes. The amount of incorporated dNTPs is determined by trichloroacetic acid precipitation followed by scintillation counting.
Volume Activity: 5 U/µl

Modified nucleotides are substrates
Pwo DNA Polymerase accepts modified nucleotides like digoxigenin-dUTP, biotin-dUTP, or fluorescein-dUTP. Thus, it can add these nucleotides to DNA during PCR. These nonradioactively labeled products can be used as a hybridization probe in many applications.
For life science research only. Not for use in diagnostic procedures.

usage	sufficient for ≤200 reactions (04340850001), sufficient for ≤40 reactions (04340868001)
Quality Level	100,
feature	Difficult Templates/Specialty Enzymes PCR, dNTPs included: no, hotstart: no
packaging	pkg of 100 U (04340868001), pkg of 500 U (04340850001 [2 x 250 U])
Торговая марка	Roche
parameter	72 °C optimum reaction temp.
application(s)	PCR: suitable
shipped in	dry ice
storage temp.	−20°C

NONH for all modes of transport

RIDADR

Узнать цену

Подробнее

QR0200-1KT
Quantitative RT-PCR ReadyMix™ QR0200-1KT
NACRES: NA.55

General description
Quantitative RT-PCR ReadyMix™ combines Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and JumpStart™ Taq DNA polymerase in a one-step RT-PCR kit designed for the measurement of gene expression. Tis convenient 2X ready mix includes M-MLV RT, JumpStart™ Taq DNA polymerase, 99% pure deoxynucleotides, buffer, glass passivator, and stabilizers. The JumpStart™ Taq DNA polymerase is an antibody-inactivated hot-start enzyme. Once the reaction temperature reaches 70°C, the DNA polymerase-antibody complex dissociates and Taq DNA polymerase activity is restored. This antibody-enzyme complex allows for easy and convenient set-up with less contamination risk than manual hot-start techniques. This kit has been formulated for fluorogenic hybridization probe-based detection methods.
Application
Quantitative RT-PCR ReadyMix™ has been used in the quantification of messenger RNA (mRNA) levels of specific expressed genes by quantitative reverse-transcription polymerase chain reaction (RT-qPCR).
Features and Benefits
The master mix allows consistency and reproducibility from one reaction to the next
Reduced risk of contamination from multiple pipetting steps
Reduced set-up time as compared to manual or wax Hot Start methods
JumpStart™Taq Polymerase reduces primer-dimer and non-specific product formation
Broad instrument compatibility
Includes a separate ROX reference dye vial for reaction normalization

Packaging
1 kit sufficient for 250 reactions at 20 μL each or for 100 reactions at 50 μL each.
Legal Information
This product is for research use only.
JumpStart is a trademark of Sigma-Aldrich Co. LLC
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
Параметры

Quality Level 200,

feature hotstart

application(s) RT-qPCR: suitable

color colorless

detection method probe-based

shipped in wet ice

storage temp. 20°C

Safety Information

pictograms GHS07

signalword Warning

hcodes H317

pcodes P261 - P272 - P280 - P302 + P352 - P333 + P313 - P362 + P364

RIDADR NONH for all modes of transport
Узнать цену Получить предложение
Подробнее

ReadyMix™ Taq PCR Reaction Mix

MDL number:	MFCD01635810
NACRES:	NA.55

ReadyMix™ Taq PCR Reaction Mix is a prepared solution containing everything needed for a PCR reaction except the specific primers and template. The mix includes Sigmas high quality Taq DNA Polymerase, 99% pure deoxynucleotides and buffer in a 2x optimized reaction concentrate. For reaction set-up, add the ReadyMix (25 µL) to the primers, template and water (total volume 50 µL). Using ReadyMix Taq PCR Reaction Mix reduces pipetting steps and risk of contamination. This saves time and reduces errors while still providing the great performance of Sigmas Taq DNA Polymerase.

ReadyMix™ Taq PCR Reaction Mix
has been used:

in the development and specificity test of the amplified fragment length polymorphism (AFLP) markers
in the PCR reaction for terminal restriction fragment length polymorphism (T-RFLP) analysis
in the molecular identification of yeasts

For routine PCR amplifications
Features and Benefits

Amplifies targets up to 7 kb in length

ReadyMix Taq PCR Reaction Mix offers the same great performance as Taq DNA Polymerase in a more convenient formulation

ReadyMix format reduces setup time.

Reduced risk of contamination from multiple pipet steps.

Packaging
Supplied with a vial of PCR grade water for dilution.
Default reaction volume is 50 µL
100RXN is packaged as 1 X 2.5 mL
Unit Definition
One unit incorporates 10 nmol of total dNTPs into acid-precipitable DNA in 30 min. at 74 °C.

Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US: 5,789,224, 5,618,711, 6,127,155 and claims outside the US corresponding to expired US Patent No. 5,079,352. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchasers own internal research. No right under any other patent claim, no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchasers activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC

Quality Level	200,
form	liquid
feature	dNTPs included, hotstart: no
concentration	1.5 units/reaction (50 µL reaction volume)
application(s)	PCR: suitable
color	colorless
Featured Industry	Agriculture
shipped in	wet ice
storage temp.	20°C