Gene Editing & Functional Genomics
- Сортировать:
- Вид таблицей
-
MISSION® shRNA Human Gene Family Set, DNA SH0821
NACRES: NA.51 General descriptionSequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 106, Number of Clones: 528
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 20°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, DNA SH1021
NACRES: NA.51 General descriptionSequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 278, Number of Clones: 1456
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 20°C Gene Information Узнать цену -
MISSION® shRNA Human Gene Family Set, DNA SH1121
NACRES: NA.51 General descriptionSequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
Number of Genes: 218, Number of Clones: 1448
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 20°C Gene Information human ... AR(367), ESR1(2099), ESR2(2100), ESRRA(2101), ESRRB(2103), ESRRG(2104), HNF4A(3172), HNF4G(3174), NR0B1(190), NR0B2(8431), NR1D1(9572), NR1D2(9975), NR1H2(7376), NR1H3(10062), NR1H4(9971), NR1I2(8856), NR1I3(9970), NR2C1(7181), NR2C2(7182), NR2E1(7101), NR2E3(10002), NR2F2(7026), NR2F6(2063), NR3C2(4306), NR4A1(3164), NR4A2(4929), NR4A3(8013), NR5A1(2516), NR5A2(2494), NR6A1(2649), PGR(5241), PPARA(5465), PPARD(5467), PPARG(5468), RARA(5914), RARB(5915), RARG(5916), RORA(6095), RORB(6096), RORC(6097), RXRA(6256), RXRB(6257), RXRG(6258), THRA(7067), THRB(7068), VDR(7421)
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, DNA SH1321
NACRES: NA.51 General descriptionSequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 93, Number of Clones: 584
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 20°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0731
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50μl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 124, Number of Clones: 818
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2131
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50μl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 341, Number of Clones: 2081
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH1831
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50μl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 117, Number of Clones: 837
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2231
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50μl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 368, Number of Clones: 2396
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2331
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 275, Number of Clones: 1991
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2431
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 242, Number of Clones: 1865
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2531
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 331, Number of Clones: 1968
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2631
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 136, Number of Clones: 909
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2731
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 190, Number of Clones: 1358
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2831
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 73, Number of Clones: 575
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH2931
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.
Number of Genes: 99, Number of Clones: 661Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH3031
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 11, Number of Clones: 57
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information human ... CA1(759), DNMT1(1786), DNMT3A(1788), DNMT3B(1789), DNMT3L(29947), MGMT(4255), N6AMT1(29104), N6AMT2(221143), SPEM1(374768), TRDMT1(1787)
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0431
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 317, Number of Clones: 2065
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH1331
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 93, Number of Clones: 584
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH1931
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 443, Number of Clones: 3512
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH1131
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
Number of Genes: 218, Number of Clones: 1448
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information human ... AR(367), ESR1(2099), ESR2(2100), ESRRA(2101), ESRRB(2103), ESRRG(2104), HNF4A(3172), HNF4G(3174), NR0B1(190), NR0B2(8431), NR1D1(9572), NR1D2(9975), NR1H2(7376), NR1H3(10062), NR1H4(9971), NR1I2(8856), NR1I3(9970), NR2C1(7181), NR2C2(7182), NR2E1(7101), NR2E3(10002), NR2F2(7026), NR2F6(2063), NR3C2(4306), NR4A1(3164), NR4A2(4929), NR4A3(8013), NR5A1(2516), NR5A2(2494), NR6A1(2649), PGR(5241), PPARA(5465), PPARD(5467), PPARG(5468), RARA(5914), RARB(5915), RARG(5916), RORA(6095), RORB(6096), RORC(6097), RXRA(6256), RXRB(6257), RXRG(6258), THRA(7067), THRB(7068), VDR(7421)
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0831
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesNumber of Genes: 106, Number of Clones: 528
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0231
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 541, Number of Clones: 2864
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH1031
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 278, Number of Clones: 1456
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0131
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes:746, Number of Clones: 9418
Avg. Clones per Gene: 12.6
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Human Gene Family Set, Lentiviral Particles SH0531
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50µl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com,. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.ApplicationMISSION® shRNA human gene family set, lentiviral particles has been used in pRb downregulation.Other NotesNumber of Genes: 73, Number of Clones: 575
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields,, Gloves,, multi-purpose combination respirator cartridge (US), RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Bacterial Glycerol Stock SM0111
NACRES: NA.51 General descriptionThe clones are sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) provided as 50 μl bacterial glycerol stocks (Terrific Broth, carbenicillin at 100 μg/ml and 15% glycerol). The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 659, Number of Clones: 3210
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 2 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Bacterial Glycerol Stock SM2011
NACRES: NA.51 General descriptionThe clones are sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) provided as 50 μl bacterial glycerol stocks (Terrific Broth, carbenicillin at 100 μg/ml and 15% glycerol). The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 133, Number of Cones: 850
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Bacterial Glycerol Stock SM0411
NACRES: NA.51 General descriptionThe clones are sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) provided as 50 μl bacterial glycerol stocks (Terrific Broth, carbenicillin at 100 μg/ml and 15% glycerol). The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesEach MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 290, Number of Clones: 1734
For a detailed listing of other available gene family sets, visit the gene family set website,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® storage temp. 70°C Gene Information Узнать цену -
MISSION® shRNA Mouse Gene Family Set, DNA SM0421
NACRES: NA.51 General descriptionFor a detailed listing of other available gene family sets, visit the gene family set website.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
Sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesThe exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 290, Number of Clones: 1734Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 20°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, DNA SM0121
NACRES: NA.51 General descriptionFor a detailed listing of other available gene family sets, visit the gene family set website.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
Sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesThe exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 618, Number of Clones: 3916Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 20°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, DNA SM2021
NACRES: NA.51 General descriptionFor a detailed listing of other available gene family sets, visit the gene family set website.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
Sequenced-verified shRNA lentiviral plasmids (pLKO.1-puro) are provided as purified plasmid DNA suitable for virus production and transient transfection. DNA is provided in 40 μl aliquots per well in Tris,EDTA (TE) solution. An average of 2 μg per clone is provided per well with a range from 400 ng to 4 μg. The set comes in 96-well plates that are barcoded for simple identification. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.Other NotesThe exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 133, Number of Cones: 850Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 20°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Lentiviral Particles SM2031
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.Other NotesThe exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 133, Number of Cones: 850
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Lentiviral Particles SM0431
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.Other NotesNumber of Genes: 219, Number of Clones: 1086
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® shRNA Mouse Gene Family Set, Lentiviral Particles SM0131
NACRES: NA.51 General descriptionLentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.
Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.Other NotesThe exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.
Number of Genes: 618, Number of Clones: 3916
For a detailed listing of other available gene family sets, visit the gene family set website.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense.
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. 70°C Gene Information
Safety InformationPersonal Protective Equipment Eyeshields, Gloves, multi-purpose combination respirator cartridge (US) RIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
CRISPR & MISSION® Lentiviral Packaging Mix
NACRES: NA.51
Кат. номер SHP002-1.7ML SHP002-0.25ML General descriptionThe CRISPR & MISSION Lentiviral Packaging Mix is an optimized formulation of two plasmids expressing the key HIV packaging genes and a heterologous viral envelope gene.
Lentiviral particles are generated from three main components:- The packaging vector, which contains the minimal set of lentiviral genes required to generate the virion structural proteins and packaging functions.
- The vesicular stomatitis virus G-protein envelope vector, which provides the heterologous envelope for pseudotyping and allows these lentiviral particles to efficiently deliver the transfer sequence of interest to a wide variety of cell types, including primary and non-dividing cells
- The lentiviral transfer vector, which contains the sequence of interest as well as the cis acting sequences necessary for packaging.
The Lentiviral Packaging Mix contains the first two components; it is designed to be co-transfected along with a compatible lentiviral transfer vector in order to create high-titer pseudo-typed lentiviral particles used for downstream transduction applications. This product is recommended for packaging Lenti CRISPR, Lenti ORF, and Lenti shRNA vectors.ApplicationFunctional Genomics/Screening/Target ValidationLegal InformationCRISPR Use License Agreement
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 concentration 100 ng/µL (in Tris-EDTA) application(s) CRISPR: suitable shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 2 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® 1X LacO Inducible Non-Target shRNA Control Plasmid DNA SHC312-1EA
Ballschmiter Number: 12000000 MDL number: MFCD07785395 NACRES: NA.51 General descriptionSigma® is proud to offer IPTG-inducible vectors as the latest development from our continued partnership in TRC.
The pLKO vector has been redesigned to contain a LacI (repressor) and a modified human U6 shRNA promoter with LacO (operator) sequences. In the absence of IPTG (isopropyl--D-thio-galactoside), an analogue of lactose, LacI binds to LacO preventing expression of the shRNA. When IPTG is present, the allosteric LacI repressor changes conformation, releasing itself from lacO modified human U6 promoter, and subsequently allows expression of the shRNA.
The vector contains an shRNA insert that does not target any known genes, making it useful as a negative control in experiments using the MISSION inducible shRNA library clones. This allows one to examine the effect of transfection of a short-hairpin on gene expression and interpret the knockdown effect seen with shRNA clones. Ampicillin and puromycin antibiotic resistance genes provide selection in bacterial or mammalian cells respectively. In addition, self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. The 1X LacO Inducible Non-Target shRNA Control is provided as 10 µg of plasmid DNA in Tris-EDTA (TE) buffer at a concentration of 500 ng/µl.ApplicationTo see more application data, protocols, vector maps visit sigma.com/shrna,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense,.
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Sigma is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® concentration 500 ng/µL in TE buffer; DNA (10µg of plasmid DNA) shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® 1X LacO Inducible Non-Target shRNA Control Transduction Particles SHC312V-1EA
NACRES: NA.51 General descriptionSigma® is proud to offer IPTG-inducible vectors as the latest development from our continued partnership in TRC.
The pLKO vector has been redesigned to contain a LacI (repressor) and a modified human U6 shRNA promoter with LacO (operator) sequences. In the absence of IPTG (isopropyl--D-thio-galactoside), an analogue of lactose, LacI binds to LacO preventing expression of the shRNA. When IPTG is present, the allosteric LacI repressor changes conformation, releasing itself from lacO modified human U6 promoter, and subsequently allows expression of the shRNA.
The MISSION 1x LacO Inducible Non-Target shRNA Control Transduction Particles contain an shRNA insert that does not target any known genes, making it useful as a negative control in experiments using the MISSION inducible shRNA library clones. This allows one to examine the effect of transfection of a short-hairpin on gene expression and interpret the knockdown effect seen with shRNA clones. Ampicillin and puromycin antibiotic resistance genes provide selection in bacterial or mammalian cells respectively. In addition, self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. 200uL of 106 TU/ml (via p24 titering assay) lentiviral particles are provided as frozen stock.
When conducting experiments using MISSION® shRNA clones, the proper controls should be a key element of your experimental design to allow for accurate interpretation of knockdown results.ApplicationTo see more application data, protocols, vector maps visit sigma.com/shrna,.Legal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLC
Sigma is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® concentration 1x106 VP/ml (via p24 assay) shipped in dry ice storage temp. 70°C
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® 3X LacO Inducible Non-Target shRNA Control Plasmid DNA SHC332-1EA
MDL number: MFCD07785395 NACRES: NA.51 General descriptionSigma® is proud to offer IPTG-inducible vectors as the latest development from our continued partnership in TRC.
The pLKO vector has been redesigned to contain a LacI (repressor) and a modified human U6 shRNA promoter with LacO (operator) sequences. In the absence of IPTG (isopropyl--D-thio-galactoside), an analogue of lactose, LacI binds to LacO preventing expression of the shRNA. When IPTG is present, the allosteric LacI repressor changes conformation, releasing itself from lacO modified human U6 promoter, and subsequently allows expression of the shRNA.
We are proud to offer two different IPTG inducible vectors for your research. The preferred inducible vector, pLKO_IPTG_3xLacO, contains three lac operon sequences (two in the U6 promoter and one 3 of the promoter) affording both tight regulation and great gene silencing. Whereas, the pLKO_IPTG_1xLacO vector contains a single lac operon sequence in the U6 promoter, which allows for an advantage to shRNA expression, but looser control of the promoter when not induced.
The MISSION® 3X LacO Inducible Non-Target shRNA Control is a lentivirus plasmid vector. The vector contains an shRNA insert that does not target any known genes, making it useful as a negative control in experiments using the MISSION inducible shRNA library clones. This allows one to examine the effect of transfection of a short-hairpin on gene expression and interpret the knockdown effect seen with shRNA clones. Ampicillin and puromycin antibiotic resistance genes provide selection in bacterial or mammalian cells respectively. In addition, self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. The 1X LacO Inducible Non-Target shRNA Control is provided as 10 µg of plasmid DNA in Tris-EDTA (TE) buffer at a concentration of 500 ng/µl.ApplicationTo see more application data, protocols, vector maps visit sigma.com/shrna,.Legal InformationUse of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense,.
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Sigma is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® concentration 500 ng/µL in TE buffer; DNA (10µg of plasmid DNA) shipped in dry ice storage temp. 20°C
Safety InformationRIDADR NONH for all modes of transport WGK Germany WGK 1 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® 3X LacO Inducible Non-Target shRNA Control Transduction Particles SHC332V-1EA
General descriptionSigma® is proud to offer IPTG-inducible vectors as the latest development from our continued partnership in TRC.
The pLKO vector has been redesigned to contain a LacI (repressor) and a modified human U6 shRNA promoter with LacO (operator) sequences. In the absence of IPTG (isopropyl--D-thio-galactoside), an analogue of lactose, LacI binds to LacO preventing expression of the shRNA. When IPTG is present, the allosteric LacI repressor changes conformation, releasing itself from lacO modified human U6 promoter, and subsequently allows expression of the shRNA.
The MISSION 3x LacO Inducible Non-Target shRNA Control Transduction Particles contain an shRNA insert that does not target any known genes, making it useful as a negative control in experiments using the MISSION inducible shRNA library clones. This allows one to examine the effect of transfection of a short-hairpin on gene expression and interpret the knockdown effect seen with shRNA clones. Ampicillin and puromycin antibiotic resistance genes provide selection in bacterial or mammalian cells respectively. In addition, self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. 200 uL of 106 TU/ml (via p24 titering assay) lentiviral particles are provided as frozen stock.
When conducting experiments using MISSION® shRNA clones, the proper controls should be a key element of your experimental design to allow for accurate interpretation of knockdown results.ApplicationTo see more application data, protocols, vector maps visit sigma.com/shrna,.Legal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLC
Sigma is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® concentration 1x106 VP/ml (via p24 assay)
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® ExpressMag® 96-Well Magnet
NACRES: NA.51
Кат. номер SHM05-1EA-KC SHM05-1EA General descriptionTo view protocols from Sigma collaborators for ExpressMag system visit the link below.
www.sigmaaldrich.com/mission-protocolsApplicationMISSION® ExpressMag® 96-Well Magnet exerts a magnetic force used to attract magnetic nanoparticles to the surface of cells in culture. This product is optimized for use with 96-well tissue culture plates.CautionMagnets should be kept away from magnetic storage devices, such as hard disks, ID cards, and credit cards, and from electronic devices and ferromagnetic materials. Persons with cardiac pacemakers should not work with these magnets.
Do not autoclave! Clean surface with 70% isopropyl alcohol.Legal InformationExpressMag is a registered trademark of Sigma-Aldrich Co. LLC
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. room temp Узнать цену -
MISSION® ExpressMag® 96-Well Magnetic Kit SHM02-1KT
NACRES: NA.51 General descriptionTo view protocols from Sigma collaborators for ExpressMag system visit the link below.
www.sigmaaldrich.com/mission-protocols,ApplicationMISSION® ExpressMag® 96-Well Magnetic Kit contains all of the components needed to start enhancing your lentiviral transductions. The kit contains a 100 µL vial of ExpressMag™ Beads, enough for 63 wells of a 96 well plate. These beads bind the lentiviral particles and enable the ExpressMag™ magnetic plate to pull the virus down to the surface of cells thereby significantly increasing transduction efficiency. This product is specifically designed to work with 96-well plates. The kit has been documented to enhance MISSION lentiviral transduction of suspension 293T as well as allowing the transduction of primary human cells such as keratinocytes at MOI as low as 1. See the technical bulletin for other cell lines transduced with the ExpressMag system.
MISSION® ExpressMag® 96-Well Magnetic Kit has been used in hepatitis C virus (HCV) replicon luciferase assay.
Warning
Magnets should be kept away from magnetic storage devices, such as hard disks, ID cards, and credit cards, and from electronic devices and ferromagnetic materials. Persons with cardiac pacemakers should not work with these magnets.Legal InformationExpressMag is a registered trademark of Sigma-Aldrich Co. LLC
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® shelf life 2 yr at ~4 °C storage temp. 2-8°C
Safety InformationRIDADR NONH for all modes of transport Узнать цену -
MISSION® ExpressMag® Beads
NACRES: NA.51
Кат. номер SHM03-100UL SHM03-100UL-KC SHM03-5ML SHM03-300UL SHM03-10ML SHM03-1ML General descriptionTo view protocols from Sigma collaborators for ExpressMag system visit the link below.
www.sigmaaldrich.com/mission-protocolsApplicationWhen coupled with MISSION® ExpressMag® magnetics, ExpressMag beads will increase the transduction efficiency of lentiviral particles. Increases in transduction efficiency are particularly striking in primary cells and in suspension cells.Preparation NoteDo NOT FREEZE! Significant decrease in efficacy will occur if ExpressMag bead solution is frozen.Legal InformationExpressMag is a registered trademark of Sigma-Aldrich Co. LLC
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® shelf life 3 yr storage temp. 2-8°C
Safety InformationPersonal Protective Equipment Eyeshields, Gloves RIDADR NONH for all modes of transport WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® ExpressMag® Super Magnetic Kit SHM01-1KT
General descriptionTo view protocols from Sigma collaborators for ExpressMag system visit the link below.
www.sigmaaldrich.com/mission-protocols,ApplicationMISSION® ExpressMag® Super Magnetic Kit contains all of the components needed to start enhancing your lentiviral transductions. The kit contains a 100 µL vial of ExpressMag™ Beads, enough for 63 wells of a 96 well plate. These beads bind the lentiviral particles and enable the ExpressMag™ magnetic plate to pull the virus down to the surface of cells thereby significantly increasing transduction efficiency. This product can be used in conjunction with standard sized well plates, T-25 through T-75 tissue culture flasks, and up to 5 cm dishes. The kit has been documented to enhance MISSION® lentiviral transduction of suspension 293T as well as allowing the transduction of primary human cells such as keratinocytes at MOI as low as 1. See the technical bulletin for other cell lines transduced with the ExpressMag™ system.
Caution
Do not autoclave! Clean surface of magnet with 70% isopropyl alcohol.
Magnets should be kept away from magnetic storage devices, such as hard disks, ID cards, and credit cards, and from electronic devices and ferromagnetic materials. Persons with cardiac pacemakers should not work with these magnets.Legal InformationExpressMag is a registered trademark of Sigma-Aldrich Co. LLC
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200, product line MISSION® shelf life 2 yr at ~4 °C storage temp. 2-8°C
Safety InformationRIDADR NONH for all modes of transport Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® ExpressMag® Super Magnetic Plate
NACRES: NA.51
Кат. номер SHM04-1EA-KC SHM04-1EA General descriptionTo view protocols from Sigma collaborators for ExpressMag system visit the link below.
www.sigmaaldrich.com/mission-protocolsApplicationMISSION® ExpressMag® Super Magnetic Plate exerts a magnetic force used to attract magnetic nanoparticles to the surface of cells in culture. This product can be used in conjunction with standard sized well plates, T-25 through T-75 tissue culture flasks, and up to 5 cm dishes.
Magnets should be kept away from magnetic storage devices, such as hard disks, ID cards, and credit cards, and from electronic devices and ferromagnetic materials. Persons with cardiac pacemakers should not work with these magnets.
It has been used to culture rat neural stem cells for transfection of green fluorescent protein.
MISSION® ExpressMag® Super Magnetic Plate exerts a magnetic force used to attract magnetic nanoparticles to the surface of cells in culture.CautionDo not autoclave! Clean surface with 70% isopropyl alcohol.Legal InformationExpressMag is a registered trademark of Sigma-Aldrich Co. LLC
MISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® storage temp. room temp Узнать цену -
MISSION® Lenti microRNA Inhibitor HLTUD001C
NACRES: NA.51 General descriptionIndividual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other NotesBased on miRBase V19 Mature IDLegal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® concentration 1x106 VP/ml (via p24 assay) mature sequence GGUUCGUACGUACACUGUUCA Sanger mature/minor accession no. MIMAT0001324, Sanger microRNA accession no. MI0001427, shipped in dry ice storage temp. 70°C
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® Lenti microRNA Inhibitor, Human HLTUD0354
NACRES: NA.51 General descriptionIndividual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other NotesBased on miRBase V19 Mature IDLegal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® concentration 1x106 VP/ml (via p24 assay) application(s) capture ELISA: 106 TU/mL using p24 (Volume 200 uL) mature sequence UAAUACUGCCGGGUAAUGAUGGA Sanger mature/minor accession no. MIMAT0000617, Sanger microRNA accession no. MI0000650, shipped in dry ice storage temp. 70°C
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® Lenti microRNA Inhibitor, Human HLTUD1615
NACRES: NA.51 General descriptionIndividual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other NotesBased on miRBase V19 Mature IDLegal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® concentration 1x106 VP/ml (via p24 assay) application(s) capture ELISA: 106 TU/mL using p24 (Volume 200 uL) mature sequence AACUCGUGUUCAAAGCCUUUAG Sanger mature/minor accession no. MIMAT0019693, Sanger microRNA accession no. MI0017263, shipped in dry ice storage temp. 70°C
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену -
MISSION® Lenti microRNA Inhibitor, Human HLTUD1154
NACRES: NA.51 General descriptionIndividual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other NotesBased on miRBase V19 Mature IDLegal InformationMISSION is a registered trademark of Sigma-Aldrich Co. LLCПараметрыQuality Level 200 product line MISSION® concentration 1x106 VP/ml (via p24 assay) application(s) capture ELISA: 106 TU/mL using p24 (Volume 200 uL) mature sequence AGGGACUGCCUUAGGAGAAAGUU Sanger mature/minor accession no. MIMAT0015084, Sanger microRNA accession no. MI0014247,","MI0014248, shipped in dry ice storage temp. 70°C
Safety InformationRIDADR UN 3245 9 WGK Germany WGK 3 Flash Point F Not applicable Flash Point C Not applicable Узнать цену
Получите коммерческое предложение в течение 1 часа
Менеджер подготовит коммерческое предложение и позвонит, если понадобится уточнить детали вашего заказа
Анна Гловацкая
Менеджер по работе с клиентами
С 2010 года мы поставляем оборудование с заводов Европы. Берем на себя все — от подбора оборудования до внедрения на предприятии
Все сотрудники имеют высшее образование, закончили ведущие химические вузы страны, такие как РХТУ им Менделеева.
У большинства компаний срок ожидания составляет 10-12 недель.
Оборудование хранится на сухом отапливаемом складе, где поддерживается ровная температура.
Работаем с PonyExpress и Деловыми линиями. Вы также можете выбрать свою транспортную компанию или забрать товар со склада в Москве.
В случае любых неполадок за свой счет выполним ремонт в сервисном центре или на заводе-изготовителе. Или бесплатно заменим прибор на новый.
Производим пуско-наладку оборудования, валидацию, обучение сотрудников. Если нужно, привлекаем инженеров с заводов- изготовителей.
